1

WP_Post Object ( [ID] => 9808 [post_author] => 1759 [post_date] => 2018-03-17 03:06:02 [post_date_gmt] => 2018-03-17 03:06:02 [post_content] =>

Wesley J. Wildman, a liberal evangelical Christian, contributed this issue’s sermon as part of the ongoing “From the Pulpit” series. Provocatively titled “Narnia’s Aslan, Earth’s Darwin, and Heaven’s God” (see pp. 210–17), it details some of the waste and brutality of natural selection that are inevitable accompaniments of evolution. “Surely such a loving, personal Deity would have created in another way,” he queries, “a way that involved less trial and error, fewer false starts, fewer mindless species extinctions, fewer pointless cruelties, and less reliance on predation to sort out the fit from the unfit” (214). In conclusion, he poses the far-from-rhetorical question: “What sort of God could, would, and did create the world through evolution?” (217). He shows that evolution has striking implications for theology—including LDS theology, I would add. 

And in fact, what might it mean that God “used” evolution to create life’s diversity? Was this a choice for God among other alternatives? Do Wildman’s pessimistic conclusions hold for Mormonism? Does evolution imply a noninterventionist Deity? Are there more optimistic views possible, some of which may actually suggest that evolution enhances and expands our view of God? Are adjustments necessary to our key doctrines of the Creation, Fall, and Atonement to accommodate an evolutionary perspective? And why should we make this accommodation? What is lost and what is gained if our faith community fully and without compromise embraces evolution? There are deep and unavoidable theological implications for incorporating into our theology the belief that natural selection structured the way life evolved on our planet. 

I would like to sketch some of these implications. By “sketch,” I mean that I intend to rough out some of the potential problems and perplexities that will need to be sorted through in embracing a fully compatible perspective between evolution through natural selection and our faith. In this conspectus, I hope to gesture to possible solutions to the perplexities that merging evolution and theology may bring to LDS thought. There are many sticking points, and I mean only to make a beginning and to seed conversation. I make no claims that the results are either complete or thorough, but I hope that making such a start will be useful. 

Another potential difficulty is that some of the proposed solutions to the identified problems cannot be sorted out except through further revelation. Since we Mormons fully believe that further light and knowledge await bestowal, its current incompleteness should neither surprise nor disturb us. Ruminations such as these might serve as a catalyst for the kinds of questions that must be asked before revelation can be given. In scriptural and LDS history, questions are well known to have opened every major revelation from the First Vision to the 1978 revelation on priesthood ordination for worthy black men. Questions such as those orbiting a reconciliation of evolution and our faith are difficult and will sometimes remain without answers, yet that does not mean we should not ask them. Elie Wiesel captures this need nicely in a conversation with a friend: 

“Man comes closer to God through the questions he asks Him, he liked to say. Therein lies true dialogue. Man asks and God replies. But we don’t understand His replies. We cannot understand them. Because they dwell in the depths of our souls and remain there until we die. The real answers, Eliezer, you will find only within yourself.” 

“And why do you pray, Moishe?” I asked him. 

“I pray to the God within me for the strength to ask Him the real questions.”[1]

For the purposes of this paper I will assume that evolution through natural selection is a true description of how life arose on this planet and that life on Earth has emerged through a completely Darwinian process; furthermore, throughout this paper, by “Darwinian,” I mean evolution through natural selection. Much has been written on the nature of the evidence supporting these claims, including the evidence found in the fossil record, comparative anatomy, geological stratigraphic analysis, DNA molecular studies, the physics of radiometric data, etc., and I will not here debate the nature of the evidence nor the conclusions drawn from inferences made from that evidence. Here, I accept them as accurate according to the current understandings in contemporary evolutionary science. The LDS tradition also has a rich history of attempts at legitimizing and reconciling evolutionary science to the faith and tracing views of evolution within Mormonism, historically and contemporaneously.[2] This project is different in that I assume from the outset that evolution through natural selection has been established as true (and I use that word very deliberately) and that there is a legitimate, faithful response both to doctrine and to our best understanding of how life on Earth unfolds. 

Because evolution through natural selection is thought to be a universal principle[3] or physical algorithm[4] let me briefly give the necessary ingredients for its operation and tease apart why natural selection creates tension for LDS theology. 

Evolution by natural selection requires three elements: (1) variation in traits, including a source of novel variation; (2) selection on trait differences based on the environment in which relevant entities are embedded, and (3) offspring able to inherit trait differences from their parents. Often a fourth, embedded in the above conditions, is made explicit: (4) time. 

If these conditions are in place, natural selection will enhance how well the object fits local environmental circumstances. This adaptation will occur whether those entities are chemicals, organisms, or digital computer programs. Within the philosophy of biology, this phenomenon is referred to as an a priori principle, rather than a cause. The task, then, of the empirical scientist is to show that a particular kind of entity is just the sort of thing to which these four principles apply. I will focus on the evolution of organisms on Earth because it is our best and clearest example. 

These principles have theological implications. First, note that this process is competitive. Some of those organisms are selected at the expense of others. There are winners and losers. Second, the variation is random with respect to what will be successful and unsuccessful. The organisms are confronted with both the requirements for survival and the local environment in which they find themselves. These factors create a direction in selection: toward better fit with that environment. Evolution is then determined by which traits succeed in a given local environment and which do not. There is no grand overall direction toward which it moves, no master plan which it fulfills. The evolutionary process is blind variation in traits being chosen at a specific location and time that results in some organisms being more successful than others in the local environment in which they are reproducing. 

Third, these competitive bouts are played out in units of energy. Over time, these energy exchanges create a positive feedback loop. The organisms that are able to capture the most energy and employ it for successful survival are most likely to replace other entities in the next generation by entities with traits like their own. Two basic strategies have been especially useful in survival: (1) using chemical changes induced by the energy of sunlight or heat to create energy in more usable forms to maintain the organism’s structure and function, and (2) stealing this energy from those who create it or from others who have stolen it. Most plants are good examples of the first strategy; cattle and puma are examples of the second. 

Empirical observations on how evolution has played out to date on Earth depict a process that is enormously creative, patulous (spreading widely from a center), complex, and diverse. All of these characteristics increase through time as the history of life on Earth unfolds. This increase, scientists believe, occurs because, as organisms evolve, they tend to transform their environment; these modifications change the selective regime in which organisms are embedded; and these changes cause even more complexity. This pattern of increased environmental complexity is called niche construction in evolutionary biology.[5] For example, when life forms moved from Earth’s early oceans to land, plants opened new niches. These vegetative incursions created new habitats as plants competed for limited resources and diversified over time to capture those limited resources. Next, insects began exploiting these plants, which further changed the environment, allowing a greater diversification of habitats. Amphibians then exploited both of these new feeding opportunities, followed in turn by reptiles, then birds, and then mammals. Each of these waves of diversity opened new niches and habitats, creating further occasions for exploitation in the competitive interactions of organisms and increasing habitat diversity, organism complexity, and the amount of creativity in the universe. 

This narrative is the standard, empirically based, scientific explanation of every example of structured life on Earth. God enters this story (or fails to do so) with no necessary explanatory power. Wildman identifies this tension quite well, because God has long been used as an explanation for otherwise puzzling aspects of life on Earth and its abundant and obviously designed features. For example, Xenophon’s Socrates pointed out in the fourth century B.C. that nature’s numerous designed aspects suggest a designer: “Again, the incisors of all creatures are adapted for cutting, the molars for receiving food from them and grinding it. And again, the mouth through which the food they want goes in, is set near the eyes and nostrils; but since what goes out is unpleasant, the ducts through which it passes are turned away and removed as far as possible from the organs of sense. With such signs of forethought in these arrangements, can you doubt whether they are the works of chance or design?” Aristodemus, Socrates’s interlocutor, answers: “No, of course not. When I regard them in this light they do look very like the handiwork of a wise and loving creator.”[6]

The argument that design implies an outside designer runs very deep, from antiquity up into the modern period. William Paley developed its most carefully articulated expression in his Natural Theology (1802). In it, he famously argues that, were you to find a watch on the beach, you would never attempt to claim that it had been produced by natural processes. Its very existence implies a watchmaker.[7] Darwin had read Paley thoroughly and understood that any explanation of the origin of life on Earth must include an explanation of design. Evolution by natural selection does so. Despite unscientific attempts to deny this achievement— for example, by the Discovery Institute’s cleverly conceived “intelligent design” movement[8]—most scientists agree that evolution provides a sufficient explanation of design. In fact, the Darwinian conclusion that design is not evidence of a designer has been one of evolution’s most threatening aspects. 

What are the implications of design-without-a-designer for theology? More specifically, what are its implications for LDS thought and philosophy? To explore this question in detail, I want to draw on distinctions in theological outlooks made by Niels Gregersen, University of Copenhagen professor of theology.[9] He identifies five theological responses to the idea of “emergence” that serve elegantly to partition the space of responses to evolution. “Emergence” is the idea that properties of a complex system may arise that are unpredictable or unanticipated from a reductive description of lower-level processes. Emergent properties are generally explainable by the lower-level processes but rely on complex, local interactions. A classic example is a snowflake, the existence of which would have been hard to predict just from the properties of freezing water, but which is explicable in terms of those properties. 

I find these five responses useful for exploring evolution theologically because, in part, evolution and emergence are twin concepts that play in, about, and through each other in integrated ways and are part and parcel of the complexity that needs a theological response. These responses are equally useful in illuminating aspects of LDS theology. 

Gregersen’s Five Theological Responses 

The five perspectives or responses are: (1) flat religious naturalism, (2) evolving theistic naturalism, (3) atemporal theism, (4) temporal theism, and (5) eschatological theism. I will consider each perspective in turn; but interestingly, all are possible responses in LDS thought, although admittedly sometimes with a bit of twisting and hammering. Before beginning, however, a couple of clarifications are necessary to draw attention to certain aspects of LDS theology that will need special consideration as we assess the possibility of Darwin-compatible Mormon theism. Moreover, none of these models embraces a “cheap” fundamentalist creationism, by which I mean a view in which creation consists of sudden legerdemain-like wand-waving. All five perspectives try to explain emergence in terms of the full complexity of the evolutionary story as detailed in the observable physical record and currently accepted as standard by scientists. 

A difficulty that will make this project of bringing together evolution and LDS theology tough slogging is that, within LDS thinking, what we mean by a “physical universe” is often muddled. Mormonism displays a kind of expansive physicalism suggesting that the universe in toto is a farrago of matter of one kind or another (D&C 131:7), that part of it (“spirit matter”) remains undetectable by our perceptual apparatuses and instrumentation, while we have phenomenological or manipulative access only to the less “fine” or less “pure” part. This materiality includes Gods, spirits, intelligences, etc., and may exist in extra-spatial and/or temporal dimensions but does, presumably, still follow laws of some kind. All matter is subject to God’s manipulation, thanks to His greater knowledge and influence. This theological description imposes a kind of dualism in which some aspects of the universe are available to us and others are not. Lacking reliable epistemic access to the “spirit matter” part of this world, it must remain outside our scientific theories and practices, even though it may play a role in a deeper physical reality.[10]

Second, in Mormon thought, God is embodied. It is not completely clear what this means,[11] but it implies that at least in some sense God has a biology. What such a biology might entail, however, is quite speculative, but at least two key doctrines are contingent on the concept: (1) the literal physical son-father relationship of Christ to God the Father, and (2) the human capacity for a bodily theosis, which recapitulates God’s developmental process, if not completely in scope, at least in such a way that it can be considered human beings’ movement toward becoming godlike.[12] I am clearly riding roughshod over some controversial ideas about which much ink has been spilled and in which more nuance and refinement could be considered; but among average Church members whom I know, the claim “As man is, God once was. As God is, man may become” would be considered neither surprising nor controversial. 

Flat Religious Naturalism 

In Gregersen’s partitioning of religious space by emergence, the first category is flat religious naturalism. In this view, the natural world is all there is—nothing beyond the physical reality accessible to current and future science. This view, though denying anything supernatural, leaves open the possibility that other substances might be discovered. For example, dark matter would be fully acceptable in flat naturalism because it can be inferred through human observation at galactic scales. But the idea that God might use supernatural means or substances (including a soul or Descartes’s rescognitas) to accomplish His goals or purposes is dismissed. 

While this perspective might seem to be the basic grounding of a strict materialism, it still acknowledges the sacred nature of the universe.[13] An encounter with God is therefore not one of personal relationship, transcendence, or eminence, but rather one of mystery. God in this view just is nature and its processes, and the proper response is awe. Nature is, in fact, divine. This view resonates well with certain forms of Buddhism and other forms of nontheistic religion. 

While at first glance it seems unlikely that Mormonism could be situated along this axis, Mormonism does in some sense embrace a mystery about fundamental questions that have occupied post-Plotinean western religions. These questions focus on God’s nature, attributes, and powers. For example, in this view, the laws that frame and structure the matter from which all things, including God, are constituted, are not created by God, but are self-existent with Him. Matter, intelligence, and the laws that govern their interaction would be self-existent and uncreated—with some resulting confusion in the way Mormons talk about God. For example, some speak as if God created the laws of the universe and buy into anthropic arguments about God’s “fine-tuning” the universe as the law-giver, then fall into talking about God using natural, albeit possibly higher, laws to organize the universe from unorganized matter.[14]

Theologically, Mormonism offers the following intriguing revelation on matter: 

There is no such thing as immaterial matter. All spirit is matter, but it is more fine or pure, and can only be discerned by purer eyes;
We cannot see it; but when our bodies are purified we shall see that it is all matter. (D&C 131:7–8) 

Carrying this statement a little further, matter could be broadly conceived to include God, spirits, and intelligence as part of the “finer” or “purer” matter thought to make up the extended “universe.” In this context, flat religious naturalism might be conceivable in the LDS faith, as it has few answers to questions about why the universe exists as it does and embraces the idea that its constituent substances are eternal. This matter includes the intelligences that eventually became God by taking on His mantle. Therefore, mystery and awe at this scale may be the only appropriate response. 

Evolving Theistic Naturalism 

Evolving theistic naturalism is the perspective that God has emerged from the natural world and is a quality of nature itself. Nature has moved forward in increasing complexity, and part of this complexity is God. Just as consciousness emerges from neural complexity in materialist explanations of consciousness, God emerges from the complexity of the entire universe. Obviously, in this view God is not prior to the universe, nor does He act as its creator in the traditional sense. 

Mormonism does not accommodate this view very well. Seeing God as just an emergent property of the natural universe does not seem to fit with LDS theologies of any ilk. 

Atemporal Theism 

This view is the classic post-Plotinean view of God that includes the divine attributes of omnipresence, omnipotence, and omniscience. According to this view, God exists outside of time, is the rational ground of all being, and has created the universe and its laws, fine-tuning it for human life. Atemporal theism assumes that God is “outside of” time and that, in some sense, the past, present, and future are all “present” before God. An implication of this view is that God cannot be affected by the world and emphasizes His transcendence. This view is compatible both with evolution and with creationism, which posits that the world was created suddenly in all its complexity. This view of God seems to impose a strict determinism on the final teleological goal of the creation (which, again from God’s perspective occurs as a simultaneous “now”). God, in this view, is unchangeable. Human freedom may be possible, but such assertions are often incoherent, since God does “know” what you will choose and sees your exact future resulting from those choices. 

Mormon belief systems seem varied (or generally confused) on this point. Blake Ostler, in a theological study, makes the point that Joseph Smith’s doctrines, developed in Nauvoo (1839–44), do not allow this view of God, but it is not uncommon to find dis course that assumes this view.[15] For example, Apostle Neal A. Maxwell said: 

When the veil which now encloses us is no more, time will also be no more (see D&C 84:100). Even now, time is clearly not our natural dimension. Thus it is that we are never really at home in time. Alternately, we find ourselves impatiently wishing to hasten the passage of time or to hold back the dawn. We can do neither, of course. Whereas the bird is at home in the air, we are clearly not at home in time—because we belong to eternity! Time, as much as any one thing, whispers to us that we are strangers here. If time were natural to us, why is it that we have so many clocks and wear wristwatches?[16]

Yet because of the Plotineanization by conservative “Christianizing” influences, Mormonism has maintained a relationship with this view. 

Temporal Theism 

Taking the form of process theology, the theological possibilities of temporal theism have received a friendly reception among many Mormon thinkers.[17] In this view, God has a core identity that makes him God but influences, and is influenced by, temporal changes. In addition, the future is open. While it may be possible that God understands and can “see” all logical possibilities, those potentialities are realized only in some actual futures. Furthermore, those futures’ realizations depend on the actions of free agents, which may include fundamental particles and their associations. 

This viewpoint seems most open to theistic Darwinism by providing an opening for God to be part of the unfolding of the universe. This view continues to be the most promising way to harmonize the two fields and is the perspective largely embraced by Catholic scholars Teilhard de Chardin and John Haught (discussed below). 

Eschatological Theism 

The last model Gregersen explores is eschatological theism. In this perspective, emergent features in the world do not depend strictly on the past. The future is often determined by contingent events in the present that could have been otherwise had God not intervened. New futures hinge on small events that turn out to be major turning points. (Recall the proverb, “For want of a nail . . . the kingdom was lost”). Eschatological theism denies that future emergent events result exclusively from the operation of natural law; rather, God “pulls” the future into existence through such bi furcation and contingent points in history to achieve the ends that He is interested in bringing about. Thus, He exercises influence on these events. As this argument goes, the future cannot be strictly determined through an analysis of the present state of things, and a future state can be understood only retrospectively by looking into the past. It is eschatological in the sense that God’s purposes and aims can be understood only in retrospect: “The point here,” explains Gregersen, “is that potentialities do not simply reside in the past configurations of matter; they result from interplay between creaturely potencies and the coming into being of the divine possibilities offered to the world. Accordingly, the past and the present must be seen in light of the future, rather than the future being explained out of the past or the present.”[18]

This view is strongly interventionist. Contingent events in the past that were brought together were among the possibilities present at the time of the contingent event. This reading of the past, then, looks very similar to declaring that what happened was just God’s will. So in practical terms, it is not clear how this point of view offers any advantage over looking at things from the viewpoint of atemporal theism. In both, God is clearly teleologically drawing things toward a future that He has determined. 

However, from the LDS viewpoint that prophecy is an important part of how the world works, eschatological theism may be useful in showing how the specific prophecies found in the scriptures are brought to pass by God’s intent—that they were pulled into the future by divine action. 

All five of these viewpoints assume compatibility between theology and evolution. But Gregersen’s perspectives are very general, and it will be useful to look at some specific responses from philosophers and theologians to problems of teleology and design. 

Theological Responses to Evolution 

Since the moment Darwin’s On the Origin of Species appeared in 1859, theologians have responded with attempts at both dismissal and reconciliation.[19] The latter have taken the form of everything from complete acceptance—simple variations on the theme of “That’s just the way God did it!”—to deeper, more nuanced attempts at bringing the two ways of knowing together. 

To get a sense of how LDS thinking may respond to the introduction of evolution into its theological concepts, it is useful to look at how other Christian groups have responded to the chal lenge.[20] Most efforts by Catholic and Protestant theologians have focused on three aspects, all of which are also relevant to LDS responses to evolution: (1) teleology and divine purpose, with humans being an important goal toward which the universe is directed, (2) design and its implications about God’s attributes, and (3) the presence of natural evil. All three topics orbit the question of how and to what extent God acts in the world. I discuss the third topic, natural evil, separately from the first two as part of the section titled “Mormon Evolutionary Theology” below. 

Teleology and Divine Purpose 

One of the most troubling aspects in reconciling Darwinism with the idea of a personal God is its relentless lack of direction—its purposelessness on macroevolutionary scales.[21] Laypersons often interpret this lack of a “goal” as the claim that evolution is a random process, but that is not quite right. Within a local environment by random variation, inheritable traits (traits that occur through the genetic code) are selected disproportionally in such a way that those traits that provide the organism with some advantage in that environment tend to survive at higher rates. These traits are passed on to the next generation more frequently. So while there is no final goal toward which evolution tends, it is driven by selection within local environments. Nonetheless, it is correct to say that, over long time periods, evolution is not aiming at any particular direction or purpose. 

One of the first philosophers to explore how certain features found in living organisms could arise evolutionarily without teleology was French philosopher Henri Bergson (1859–1941). He saw evolution moving toward intelligence, instinct, and complexity. Bergson couched this form of evolution in terms of an élan vi tal, a life force that pushed life (and its precursor elements prior to life) forward in time, resulting in differentiation over a span of time in which the past is “gathered into a present.”[22] Michael Vaughan, in presenting Bergson’s work, explains this process as “the organized being’s ability to organize the re-emergence of creative change through the structures that it creates.”[23] This force is not seen as something “extra”—such as the vitalism[24] that Enlightenment thinkers posited to explain life—but is an inherent property of matter and assemblages of matter. Evolutionary change is seen as inventive and creative. Vaughan adds: 

The truth is that adaptation explains the sinuosities of the movement of evolution, but not its general directions, still less the movement itself. The road that leads to the town is obliged to follow the ups and downs of the hills; it adapts itself to the accidents of the ground; but the accidents of the ground are not the cause of the road, nor have they given it its direction. At every moment they furnish it with what is indispensable, namely, the soil on which it lies; but if we consider the whole of the road, instead of each of its parts, the accidents of the ground appear only as impediments or causes of delay, for the road aims simply at the town and would fain be a straight line. Just so as regards the evolution of life and the circumstances through which it passes—with this difference, that evolution does not mark out a solitary route, that it takes directions without aiming at ends, and that it remains inventive even in its adaptations. 

But, if the evolution of life is something other than a series of adaptations to accidental circumstances, so also it is not the realization of a plan. A plan is given in advance. It is represented, or at least representable, before its realization. The complete execution of it may be put off to a distant future, or even indefinitely; but the idea is none the less formidable at the present time, in terms actually given. If, on the contrary, evolution is a creation unceasingly renewed, it creates, as it goes on, not only the forms of life, but the ideas that will enable the intellect to understand it, the terms which will serve to express it. That is to say that its future overflows its present, and can not be sketched out therein in an idea.[25]

Bergson thus opens the door for a theological response (although he was not a theist as such) that allows for direction in evolution without teleology, but which nonetheless moves to places of potential theological interest such as intelligence, complexity, and even consciousness. 

Design and God’s Implied Attributes 

One of the first theologians to attempt to address these concerns was Jesuit paleontologist Pierre Teilhard de Chardin (1881– 1955). His engagement with evolution was personally costly, since his church put considerable institutional pressure on him for his insistence on a theological engagement with evolution. He saw the universe as moving toward greater and greater “seeing” and described humans as the highest expression of this ability. Each human being stands as one who can “see” himself or herself in reflexive self-awareness. Therefore, the highest expression of life is found in this subjective experience. He breaks the history of the universe into “Pre-Life,” “Life,” and “Thought,” the last of which he calls the Noosphere. The emergence of consciousness characterizes the evolutionary stage of the Noosphere. It is important to keep in mind that this capacity for thought emerges from the universe through the progression of a flat ontology. Speaking of the universe, he says: “It is beginning to seem that there is definitely more in the molecule than the atom, more in the cell than in the molecule, more in the society than in the individual, and more in mathematical construction than in the calculations and theorems,” he writes. “We are now inclined to admit that at each further degree of combination something which is irreducible to isolated elements emerges in a new order.”[26]

In Teilhard de Chardin’s view, design is inherent in the evolutionary processes, which tend inexorably toward greater and greater complexity until consciousness arrives and finds its highest expression in humans. He also embraces a strong eschatology, which he calls the Omega Point. At this point, which occurs at the end of time, the universe preserves all that has happened, including all persons and their consciousness. In the final end of the universe, a universal consciousness will emerge. This consciousness is not God, but rather the final intent and purpose of God’s creation. Teilhard de Chardin also recognizes the hard questions that arise through the brutality and wastefulness of the evolutionary process. He makes no effort or claims to understand these negative aspects but notes that such “evil” resembles “nothing so much as the way of the Cross.”[27]

While his attempt to reconcile these disparate fields has not endured as a solution to the problem of an evolutionary theology, his efforts were significant in raising questions about how to fully embrace both evolution and theology in inventive and imaginative ways. 

Since Teilhard de Chardin’s effort, many theological efforts by both Catholics and Protestants have been situated in temporal theism. An especially promising area seems to be the process theology movement.[28] In this panentheistic view, God is more than, but also present in, all matter. Current efforts to reconcile evolution and religion have found this a productive area of shared space. 

Catholic theologian John Haught argues that, in this process theology view, God is present “deeply” in creation and influences evolutionary processes in ways that are not manipulations of matter in an interventionist sense. Rather, God is deeply present in the fabric of the universe in ways that are indistinguishable to science or other forms of human observation.[29] God’s purposes un fold because they are deeply present in the created world; they appear to emerge in the universe’s overall movements and processes, moving forward in creative and unexpected ways. Haught sees creation in terms of “promise” rather than “design.” He argues that science can fully study the universe’s ontology and that its observations will be valid and informative, but that God is working on a different level. His purposes will unfold as the universe unfolds, not only as an ordering and organizing influence but also as a source of novelty: 

Theologically speaking, process theology suggests that we should logically foresee rather than be surprised, that God’s creation is not driven coercively, that it is widely experimental, and that it unfolds over the course of a considerable amount of time. To those who object that process theology is hereby illegitimately redefining the idea of God’s power in order to contrive a fit with neo-Darwinian theory, the reply is simply that no other conception of power is more consistent with the quite orthodox religious belief that God is infinite love.[30]

Haught therefore sees creation, not as a one-time event, but as an ongoing process in which God is continuously present. This unfolding is not interventionist. God is not prodding creation when it gets off-track. Rather His presence permeates all aspects of the universe. 

Anglican theologian and scientist Arthur Peacocke writes similarly that his own naturalistic theology “is also based on an evolutionary perspective of the cosmological and biological sciences. This view entails an understanding of creation by God as a continuous activity, so that dynamic models and metaphors of divine creation and creativity become necessary. The work of God as Creator is regarded as manifest all the time in those very natural processes that are unveiled by the sciences in all their regularities.”[31]

It is important to point out that, although these views are “naturalistic” in that they do not accept miraculous interventions or divine guidance, they also embrace such basic Christian ideas and values as grace, incarnation, atonement, and resurrection, albeit with significant reinterpretations. For example, Karl Peters, professor emeritus of philosophy and religion at Rollins College, after describing a particularly meaningful interaction with his family, terms it a manifestation of grace in his life: “Reflecting on this event as a classical empiricist with a non-personal model of God as the creative process, I can see how the various elements that I have described—the family relationships, the beautiful weekend, the choir music, the setting of the service, the way it was conducted, my past experiences, my understanding of God as present when love is present—all came together serendipitously as an event of grace. I can think of the event as an example of serendipitous creativity—of God as the creative process—at work in my life.”[32]

In addition to responses from process theologians, classic trinitarian Christians have also responded to developing formal Christologies that embrace evolution through natural selection as creation. Celia Deane-Drummond, chair of theology and the biological sciences at the University of Chester in Great Britain, describes the work of creation as a “theo-drama” in which the freedom of creation emerges through actor-agents. These “actors” interact freely with one another, expressing individual choices and responses. She sees God’s relationship with all of creation as an encounter. God, incarnated as Christ, enters the stage and becomes part of the play, an act that thereby affects the unfolding drama for all creation. Atonement and redemption are universal in scope, and humans have the greatest freedom to participate with Christ in redemption through His atonement. Her perspective specifically incorporates ecological concerns into the drama, with humans being required to care for and assist with Christ with the redemption of all creation. Her work is a profound reconfiguring of Christ and His mission in a Darwinian framework that may have relevance to Mormons as well as her view of a universal atonement.[33] She describes her task thus: “This is also how I have sought to present the challenge of relating Christology and evolution: Namely, it is a challenge that insists on retaining hope for the future but also probes our own identity as evolved human persons living in an evolved world.”[34]

Theologies continue to engage fruitfully and meaningfully with evolutionary biology. This ongoing conversation is important because evolution by natural selection continues to play an important role in understanding the development of life on Earth in ways that impinge directly on the idea of creation. The theologies of many religions play a role in this conversation. For example, in a 1996 statement on evolution to the Pontifical Academy of Sciences, Pope John Paul II said: “New knowledge has led to the recognition of the theory of evolution as more than a hypothesis. It is indeed remarkable that this theory has been progressively accepted by researchers, following a series of discoveries in various fields of knowledge. The convergence, neither sought nor fabricated, of the results of work that was conducted independently is in itself a significant argument in favor of this theory.”[35]

These examples show that evolution is being taken seriously as a subject for theological discourse outside Mormonism. All of these theological responses, however, usually assume classic Nicene conceptions of Deity. It is clear that process theology has been influential in framing a response to evolution. However, the LDS view of God is much different, and Catholic and process responses may not transfer adequately to Mormonism. For example, both Teilhard de Chardin and Haught assume God’s omni presence within all that exists (and beyond). While LDS thinkers would agree that God’s influence is everywhere, His actual presence is constrained by His possession of a physical body. Also, these theologians assume the trinitarian nature of God in a different way than Mormons do. Third, these responses differ from Mormon thought by their assumption that God is the author of the laws of the universe and that creation occurred ex nihilo. These differences have strong implications for the way that a Mormon theology of evolution must be constructed. 

However, other aspects translate well from Catholic and process rapprochements between religion and evolution. The concept that God is affected by His creation and that agents have agency and thereby influence the direction in which the future unfolds are ideas that line up nicely (with some adaptation) into Mormon ideas, to which we now turn. 

Mormon Evolutionary Theology 

One of the first Mormons to argue for an evolutionary-inclusive LDS theology was W. H Chamberlin. Chamberlin was part of the 1911 controversy at Brigham Young University when several scholars were dismissed because they were promoting evolution and modern biblical criticism.[36] In evolution, Chamberlin saw evidence for God’s eminence in the world. In a paper to BYU students published in its newspaper, White and Blue, on February 14, 1911, he argued that evolution can never conflict with religion because they deal with different planes of influence and interest.[37] He clarified the eminence that he saw in nature in a Deseret News article a month later on March 10: 

Without penetrating beneath the surface of the vast ocean of life and experience science has been able to perform its well-known service for mankind. The mighty deep itself suggests the magnitude of the blessing for man that will come from the religious man’s identification of the power in and through Nature, creating and sustaining it with the Spirit of God and in his successful efforts to discover and conform to the laws that condition life in harmony with the Divine nature and will.[38]

However, Chamberlin’s notion of eminence must be understood with reference to his approach to the material world. He embraced the idea of “spiritual realism”—a reaction to the naturalism of evolutionary thinker Herbert Spencer and the positivistic worldview embraced by the Vienna Circle and a growing number of European contemporaries.[39] Spiritual realism was a form of idealism that described all of existence as flowing from “a society of minds.” In that sense, it was “spiritual” and dependent on mind. W. H. Chamberlin’s brother and biographer, Ralph Chamberlin, described it thus, “The Philosophy of Spiritual Realism holds that reality is spiritual. Mind is inherent in all Nature in the form of innumerable spiritual agents or selves, which are free causes.”[40] Chamberlin posited that all “efficient” (meaning, direct) causes reflected the reality of final causes arising in minds. He did not dispute the existence of an inorganic world prior to the appearance of life in the universe. However, the outflowing of existence from mind provides evidence for panpsychism (the idea that all matter has some kind of awareness). Ralph Chamberlin, explaining his brother’s thought, said, “Matter is not inanimate, in the sense of inert, ‘but an expression of activity,’” and continued, “The elements may be interpreted as uniform methods or expressions of an underlying activity and viewed as ‘analogous to the habits as we know them in ourselves.’”[41]

Ralph Chamberlin further argued that the evolution of the entire universe, even prior to the development of life, was very similar to the way that an embryo develops, with many processes moving simultaneously toward the final goal of an individual organism: “Just as the developing embryo of the sea-urchin, or of any section of it, varies as a whole, and can be understood only as a reciprocally related set of movements working toward an end, giving the impression of being guided by a hidden pattern, so inorganic nature, prior to the organic evolution, varied in such a way as strongly to suggest a similar control.”[42] He commented that life on Earth, viewed retrospectively, seemed to have followed a similar route to the ends toward which the universe is heading that we see today in extant organisms. Quoting W. H., Ralph Chamberlin explained: 

In relation to our interests or needs, minds are the sole support of our experience of any and all objects of Nature, of their temporal and spatial relations, and especially of the causal interconnections which we discover as maintaining among the objects of Nature, and which we describe as the laws or uniformities of Nature. The minds that form that phase of life called environment embrace a priori, as living premises embrace a conclusion, the matter and energy by this environment. What man calls Nature is a symbol of the presence of mind.[43]

My reading of Chamberlin’s thought is that the conditions in which God and a society of minds find themselves as individuals includes both ourselves and all of matter which is spiritual (this is backwards from the way that most Mormons would construct the nature of matter, i.e., spirit is matter, rather than the other way around). In Chamberlin’s anti-materialist view, God is conceived as the highest entity, the most knowledgeable and powerful, in a society of minds. Like us, He is a “thou” who, through this society, brings into being the world we see around us. That world is conditioned completely by the society of minds and their goals. As Ralph Chamberlin describes it, “The world is an active, living whole, an organic system of a higher order, a product and expression of a society of minds.”[44]

Evolution here is seen as part of God’s purposes being brought forth by this society of minds. Two aspects are important for my argument. First, this approach is deeply idealistic in the sense that there is no material world, only a spiritual world of mind. Second, it is deeply teleological. While it has echoes of Bergson’s work with a universe unfolding in ways that are creative, Chamberlin appears to see God’s work moving forward in a way reminiscent of Haught’s evolution in which the evolutionary process is inextricably embedded in the universe, except that he explains this depth as “mind” moving the evolutionary process forward. 

While Chamberlin’s work is friendly to evolution and Darwinism, it is so at the expense of a physical world, an approach that creates problems from a modern scientific perspective. In addition, it is much too teleological for modern scientific views of how evolution proceeds, which have now moved away from teleological explanations. However, on the positive side, this perspective also moves away from the hermeneutic of suspicion in which early LDS thought held much of evolutionary theory. 

John A. Widtsoe, a chemist and apostle, although sympathetic to ideas from biological evolution as he understood it, did not engage Darwinism directly. He merely noted in his Rational Theology that “the exact process whereby man was placed upon the Earth was not known with certainty, nor is it vital to a clear understanding of the plan of salvation.”[45] B. H. Roberts, the most theologically minded member of the Council of the Seventy, was friendly to evolutionary ideas but discounted the contemporaneous scientific version of Darwinism in favor of panspermia, meaning that organisms of various “kinds” lived elsewhere and moved to Earth by unspecified means. Through a vitalistic life force, they developed to their present state. After rejecting three types of evolution, which he calls materialistic, agonistic, and theistic, he says: “The development theory of this chapter and work recognizes and starts with the eternity of life—the life force; and the eternity of some life forms, and the possibilities of these forms, perhaps in embryonic status, or in their simplest forms (save as to man) are transplanted to newly created worlds there to be developed each to its highest possibilities, by propagation, and yet within and under the great law of life of Genesis 1, viz., each “after,” and within, “its kind” (Gen 1:11–12, 21, 24–25).”[46]

The battle among Joseph Fielding Smith, James E. Talmage, and B. H. Roberts is well documented and need not be repeated here.[47] In short, when contemporary Christian creationism was introduced into Mormonism through Joseph Fielding Smith’s reading of Seventh-day Adventist writer and Ph.D. geologist George McCready Price’s work,[48] engagement between Mormon theology and evolutionary theory slowed to a standstill. Evolutionary theology has been slow to make headway in mainstream Mormon thought, in part, perhaps, because of the controversy that emerged from this encounter and Smith’s subsequent forceful (if not canonical) expression of his personal opinions, in books like Man: His Origin and Destiny (Salt Lake City: Deseret Book, 1954). 

But it may be time to take some steps in this direction. Creationist responses to the theory of evolution, which may have been understandable in the first half of the twentieth century, are becoming less and less tenable. I feel that it is important to begin to articulate an informed LDS theology that is friendlier to our current understanding of biological evolution. 

A couple of points should be kept in mind. These are not statements of my belief. Rather I offer them as “toy” models—ideas that we can play with to test their utility and durability. The problem of “unconceived alternatives” that has been articulated for science[49] carries even more weight in theological speculation, where a firm grasp of transcendental realities can be largely inaccessible or unavailable. This condition is especially true when both revelation and scriptures are underdetermined on the subject of how the Creation actually happened. Currently, evidence from the natural world and its scientific interpretation are the only “revelation” we have for understanding that process. The scriptures can be read in literalistic ways that are unsympathetic to evolutionary views, for example, or sympathetically if read more metaphorically. Even so, we do have enough information on the three pillars of our faith (the Creation, Fall, and Atonement) to start working toward some coherence in appraising the evidence of the natural world, especially since their associated controversies have been articulated in rather unbalanced and scientifically uninformed ways. 

What do we gain by taking Darwinian evolution seriously in LDS thought? First, we make available a conceptual space where, at a minimum, LDS theology does not oppose the most important theories of today’s science. I recognize the fluid status of scientific thought and its strengths and weaknesses, but it appears that evolution, at least, will continue to be extremely influential in understanding how life developed on Earth. It is very unlikely that anything will replace evolution through natural selection as broadly conceived in the foreseeable future. 

Second, evolution adds an interesting and informative dimension to several key doctrines. I will offer some tentative steps on how evolution may inform and be made compatible with Mormon theology. I repeat that these explorations are pump-priming for more complete development. I also suggest where these ideas may be problematic or need further sorting out. 

I want to speculate on reconciling the intersection between Mormon theology and Darwinian evolution in four areas: natural evil, design, embodiment, and teleology, then speculate (wildly) on how these can be reconciled. 

Natural Evil 

The first major theological question raised by evolution involves the existence of natural evil. Several authors have opined that LDS views have solved the classic “problem of evil.” Arguments for this assertion range from the naive stance that God is not culpable for the evils of the world because Adam and Eve chose to disobey to more nuanced views. One of them is David Paulsen’s contention that Joseph Smith rescues the theodicy problem. His theology suggests a God who is subject to certain natural laws: “Elsewhere Joseph taught that there are also ‘laws of eternal and self-existent principles—normative structures of some kind, I take it, that constitute things as they (eternally) are. What are possible instances of such laws or principles?’”[50] He argues that Joseph Smith gives three conditions under which God does not or cannot prevent evils: (1) unpreventable absolutely, (2) preventable by God but not absolutely, and (3) not preventable without preventing some greater good or causing some greater evil.[51]

If God did use such a method as natural selection, it would make sense that this method was the natural law that Paulsen de scribes as necessary—necessary because natural selection is a horrifying process, as Wildman’s essay in this issue reminds us. It is hard to imagine that evolution by natural selection is a reasonable choice for creation if other methods were available. Phillip Kitcher, philosophy professor at Columbia University, writes of the problem that evolution poses to theology: 

Many people have been troubled by human suffering, and that of other sentient creatures, and have wondered how those pains are compatible with the designs of an all-powerful and loving God. Dar win’s account of the history of life greatly enlarges the scale on which suffering takes place. Through millions of years, billions of animals experience vast amounts of pain, supposedly so that, after an enormous number of extinctions of entire species, on the tip of one twig of the evolutionary tree, there may emerge a species with the special properties that make us able to worship the Creator.[52]

This level of suffering and cruelty is problematic for most kinds of natural theology. Kitcher therefore uses the presence of these kinds of natural evil and their extent to dismiss theological claims about a loving God. He adds: 

Our conception of a providential Creator must suppose that He has constructed a shaggy-dog story, a history of life that consists of a three-billion-year curtain-raiser to the main event, in which millions of sentient beings suffer, often acutely, and that the suffering is not a by product but constitutive of the script the Creator has chosen to write. 

To contend that species have been individually created with the vestiges of their predecessors, with the junk that accumulates in the history of life is to suppose that Intelligence—or the Creator—operates by whimsy. The trouble is that the charge doesn’t go away when the action of the Creator is made more remote. For a history of life dominated by natural selection is extremely hard to understand in providential terms. . . . There is nothing kindly or providential about any of this, and it seems breathtakingly wasteful and inefficient. Indeed, if we imagine a human observer presiding over a miniaturized version of the whole show, peering down on his “creation,” it is extremely hard to equip the face with a kindly expression.[53]

If natural selection was a natural law necessary for the creation of a diverse and fully functioning universe, then Paulsen’s analysis of how LDS theology escapes the problem of evil would seem to make sense. In fact, if less cruel methods were available and God did not use them, then theologians must adduce (presumably very tricky) arguments about how this method can be reconciled with attributes of love and kindness. 

Mormon doctrines of the Creation and the Fall may (with some adventuresome speculation) also provide a rescue for the deep problem that Kitcher identifies. Mormon theology contains an inherent dualism positing that a spiritual aspect of existence mediates the consciousness of humans, plants, animals, and, indeed, the Earth itself. We have very limited details about how these spirit and material worlds interface with one another; however, taking evolution as a given natural law offers some possibilities for making the unimaginable cruelty of life, the Creation, and the Fall at least coherent. 

Biology has long since abandoned vitalism, and modern biologists see no necessary reason to view organisms as anything more than biological machines. However, one of the acknowledged “hard problems” in philosophy of mind is the idea of subjective consciousness. Such consciousness seems to extend beyond the usual kinds of explanatory gaps that science fills. Philosopher of science Colin McGinn believes that a biological explanation of consciousness is forever beyond the purview of science because, no matter how completely we understand the correlations made by science between brain states and consciousness, consciousness, with its qualitative feel, can be experienced and recognized only from within subjective experience.[54] Granted, we must be careful in claiming that science will never figure out such-and-such a problem, a claim that sets up a “God of the Gaps” dilemma, which scientific advances repeatedly yank the rug out from under. Still, providing scientific access to personal subjectivity does seem to be an inherently intractable problem. We can imagine a world unfolding strictly according to the forces of natural selection in which organisms are nothing more than biological machines—Cartesian wet robots, if you will. A Mormon-type creation, then, would be the union of these creatures (including a human body) with spirit material that allows these machines to become sentient and experiential beings. Such a union would link a consciousness-bestowing element to the material aspects of the world. 

Speculating even further afield, we could conceive of the Fall, less literally, as likewise a process of a spiritual and material coming together. This view smacks more of a kind of Gnosticism or Platonism, but even so may be worth exploring. Adam and Eve, in this view, would be the first of Heavenly Father’s spirit children to be linked to one of these biological machines, with the traditional animating creation taking place as a union between spirit and evolved material. As a result of this union, all humans and all creatures participate in the Fall—as a fall into materiality. In some sense, perhaps the participants even choose their participation. Continuing this line of thought, Christ must then, as LDS thought commonly holds, redeem all creation.[55] Rather than causing a fall as a necessary imposition on all sentient creatures, Adam and Eve open the possibility of a participatory fall, during which conscious experience enters the world. 

In this view, the natural evils of the living world did not begin until the Fall and form part of the price of experience, not only for humans, but for all creatures. Humans participate as God’s children (as per LDS theology), but their role is more to act with Christ in bringing redemption to the world of experiencing beings. Christ’s atonement becomes truly universal, opening the opportunity for both the resurrection and permanently bringing together of the spiritual and the material. This step joins experience and material existence. I argue that Mormonism, in this way, provides an answer that escapes natural theology and the deeper problem of evil, while making Christ’s atonement truly universal. This approach also allows a reconciliation with traditional views of Adam and Eve as real living persons—the first instance of sentience and the literal spirit children of God (agreed, we don’t know what that means exactly). This approach also provides something vital to the world through the Fall since, in a very technical sense, there was no death before the Fall. This kind of evolutionary-based view of the Fall also releases God from naive views that He is culpable for it. There is something inherently troubling about God’s setting up Adam to fail and fall. By analogy, it is as if I blame a mouse killed in my mouse trap for its desire for cheese rather than blaming myself for having baited and placed the trap. 

However, this approach also has troubling aspects. If we remove God’s consciousness-inducing spirit children from the bi otic world, then, logically, we have to accept that beings like Neanderthals had no consciousness. Since it is well established that many early hominins had religious practices, created art, and made intricate tools, it is hard to argue that they had no vestiges of phenomenal consciousness. This idea is also highly dualistic but in very Mormon, rather than in Cartesian, ways. 

Design in Mormon Theology 

How important to our theology is the idea that God is the designer in creation? Natural theology, starting with Augustine, has made the design and complexity of the universe one of the evidences of God through creation. These early theologies even held that God’s attributes could be read from the features of the natural world. As Xenophon’s quotation underscores, this move to see design as evidence of Deity’s involvement in creation obviously predates Christian theological speculation. Currently, we know that the natural law of evolution through natural selection[56] can fully explain the complexity of life on Earth (and presumably life elsewhere). Therefore, the question logically follows: Are the arguments for God from design necessary or important to a Mormon theology? Christian theologians and apologists have spilled significant quantities of ink over design, but why this question matters deserves some examination. For example, in relation to the embodiment of God, did He design His body? 

It seems circular to make Paleyesque arguments from design that do not mesh well with some of Mormonism’s foundational tenets, especially since arguments from design had become problematic long before Darwin. Scottish philosopher David Hume pointed out that design implies nothing about a designer and speculated that the designer of the universe could have been anything from an evil demon to a largely incompetent committee.[57] (The many blunders and inefficiencies found among Earth’s organisms were apparent even in Hume’s time, the eighteenth century.) If God’s embodiment implies some sort of biology, then the design comes from elsewhere. LDS thinkers have speculated since the time of Joseph Smith and Orson Pratt that God works within natural law. If this principle includes evolution through natural selection, it seems that attempts to distance ourselves theologically from evolution could be a grave error. Thus, if we interpret the theory of evolution in a Mormon framework, it constitutes a potentially helpful and perhaps even necessary explanation for an embodied God, rather than merely posing problems for natural theology. 

Embodiment in Mormon Theology 

We believe that, in some sense, we were created in the bodily image of God. We use scriptures like Ether 3:6 where the brother of Jared sees the Lord’s finger, which “was as the finger of a man,” to orient this belief. We also believe that “the Father has a body of flesh and bones as tangible as man’s; the Son also” (D&C 130:22). These scriptures present problems for a non-teleological process such as evolution by natural selection—but perhaps not as many problems as we might first think. Evolutionary biologist Simon Conway Morris argues that, given the vastness of the universe and the limited number of solutions to the biological engineering problems of surviving in a planetary ecosystem, humans or something like them, might be an inevitable evolutionary product.[58]

For example, reptile ichthyosaurs, mammal dolphins, and fish all have evolved very similar shapes to solve the problem of moving gracefully in oceans. These evolutionary convergences can take on very specific biological forms. Sabertooth cat-like predators who fed on large grassland mammals evolved as both marsupials (mammals with a pouch, like kangaroos and wallabies) and as mammals with placentas (e.g., bats, horses, and lions). Both marsupial and placental sabertooths were very similar in shape, ecological niche, and size. Both evolved from small rat or small opossum-like precursors. The universe is unimaginably large. Why? Allowing evolution to flower into something human-like could be one of the reasons. 

Philosopher James E. Faulconer asks an intriguing question about God’s embodiment: 

The bodies of flesh and bone with which I am familiar do not shine, have blood, cannot hover, can be wounded and die, must move through contiguous points of time-space. In short, they are not at all like the bodies of the Father and the Son. So what does it mean to say that the Father and the Son have bodies? In fact, does it mean anything at all? When I use the word “body” in any other context, I never refer to something that shines, can hover, is immortal, and moves through space seemingly without being troubled by walls and doors. Given the vast difference between what we mean by the word “body” in every other case and that to which the word refers in this case, one can legitimately ask whether the word “body” has the same meaning in this case that it has in the others.[59]

One could also legitimately ask: Is God a Homo sapiens? Is God a mammal? Scientists have speculated on what a bipedal hominid evolved from avian precursors might look like. Would it have left over structures like a pygostyle (a reduced fusion of vertebrae) instead of a tail? Slime molds can take very complex shapes in some of their life history stages. Can we imagine a human body that evolved from slime molds on another planet? It seems that many of our human features are part and parcel of our being mammals. Could being a mammal be a contingent feature of our evolution rather than an eternal part of our resurrected bodies? I don’t have any answers to these questions, but they don’t seem to be so problematic that they cannot be answered in ways that allow evolution as the mechanism of creation. These sorts of considerations significantly reduce problems of teleology, or God’s presumed purpose for human beings. 

Teleology in Mormon Thought 

If God, of necessity, used evolution to achieve His purposes, what does that say about His being able to act in the world? I need to add a cautionary note here. When I say God “uses” evolution, I recognize that, in talking about a “Creator,” it is possible that words like “allows” or “provides a space for” may be more appropriate. Nevertheless, if we embrace an evolutionary perspective, the idea of God’s intervention, petitionary prayer, and divine action to bring about His purposes become thorny issues. A nice thing about the magical view of creation is that it is no problem at all to imagine God intervening in the world. Why use evolution through natural selection in a non-teleological fashion if waving a magic wand was possible? In fact, if God can and sometimes does intervene, then why doesn’t He do it all the time? Why didn’t He do it during the Creation? This question opens an intriguing possibility: the necessary place of consciousness in divine interventions. 

In Mormon thought getting a physical body is important. Obviously, a body means that we become part of the material world, as Faulconer speculates: “Our experience of the body, the only standard we have for understanding embodiment, suggests that to say that God has a body is to say that his omniscience and omnipotence must be understood in ways quite different from traditional Christianity because embodiment implies situated openness to a world. In other words, divine embodiment also implies that God is affected by the world and by persons in his world.”[60]

So there seems to be something deeply important about physicality and spirit coming together. Could it be that the physical world can be manipulated only through consciousness-mediated direct action? Or through this kind of body that unites spirit and physical matter? When I read the scriptures, I see a God who makes arrangements for irreplaceable records to be kept, preserved, and maintained through conscious effort. He implies that, if they are not, this knowledge will be lost and not brought back through His intervention. I see the Lamanites languishing in unbelief until the sons of Mosiah are inspired to go among them. Angels bear messages to other consciousnesses but do not seem to manipulate the world in interventionist ways. Almost all of the scriptures can be re interpreted as acts of consciousness acting in the world. Christ’s miracles, especially His resurrection, seem to be an exception, but much of how God works in the world seems to be that He communicates to and through conscious beings who then use their agency to act. Stories of people inspired to stop and help a widow take on new meaning if God cannot help the widow without us. 

Speculative Conclusions 

Evolution may bear on theology in other areas, and entire dis courses could be developed on each of these topics. For example, “The Family: A Proclamation to the World” claims that gender is a condition of the preexistence.[61] Evolutionary biology has long explored the meaning of gender and sex in organisms. Studies on motherhood from the animal kingdom are providing great insights into the nature of motherhood in human beings.[62] The understanding of human sexuality and gender practices has strong relevance to Mormon doctrine, and insights from evolutionary biology may help explain challenges faced by individuals and families struggling with the gendered aspects of being human. Joan Roughgarden, a biologist at Stanford University, has carefully detailed the role that sex plays in the natural world.[63] Recently she has argued for a new model of evolution, based not on selfish genetic forces (Richard Dawkins’s selfish gene model), but on models of cooperation among creatures in a gendered and sexual con text.[64] Her ideas on cooperation are a nice model for the kinds of human and perhaps divine society that Mormon theology pos its—free agent interaction as part of a society of gendered minds. This area is new biological research, but it seems more promising than the selfish-gene model. It seems more attuned to the kinds of societies that we see forming in the natural world and which Mormon conceptions of theosis also model and predict. 

Evolutionary views of creation also steer us into a deeper engagement with the natural world, as we see ourselves quite literally connected to the creatures and ecologies around us. The idea that our world emerged from deep time through natural selection implies that the wonderful diversity we see around us is contingent, unique, and precious. They provide arguments for better stewardship of the natural environment, because its current state took an enormous length of time. The creatures of the Earth are not only there for us, but we are also there for them. A Darwinian theology argues that care for creation becomes an important aspect of God’s grace to the natural world through us. 

A melding of evolution and theology also introduces another area important in Mormon thought. Perhaps the LDS conception of theosis (and the path that leads to exaltation) suggests a Darwinian selection process in which elements of trial, testing, and proving are inherent parts of progression through the first and second estates of premortal and mortal existence. Could natural selection drive emergence forward in an eternal context as well? Are classically conceived intelligences the sorts of entities subject to natural selection? Abraham 3:21–25 describes intelligences as varying in traits relevant for theosis such as intelligence, righteousness, obedience, etc. (Recall that variation is the first condition necessary for natural selection to function.) Thinking of Christ as God’s son means that we know at least one case in which traits were in some senses inherited—and heritability is the second condition necessary for natural selection. But how broadly this principle applies is, obviously, speculative. Lastly, these traits get selected—the third condition necessary for natural selection. Evolution might not only be the principle behind the beauty, wonder, and diversity of life in the universe, but it may also drive the selection processes that help produce our eternal destiny. 

To me, evolution is an empowering idea. Linking it to our theology provides answers to several perplexing questions. It suggests that there is something wonderfully important about embodiment and why physical access to the universe is so important. Our doctrines, informed by evolution, answer questions about why such a cruel and wasteful process was chosen for creation and resituate the problem of evil. I find easy adaptations to our most important and profound doctrines. I see no reason why Mormons cannot, fully and without apology, embrace Darwinian evolution. As Darwin concluded his magnificent On the Origin of Species: “There is grandeur in this view of life, with its several powers, having been originally breathed into a few forms or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being, evolved.”[65]

---

[1] Elie Wiesel, Night, translated by Marion Wiesel (New York: Hill and Wang, 2006), 5. 

[2] See, for example, the following articles in Dialogue: A Journal of Mormon Thought: Duane E. Jeffery, “Seers, Savants, and Evolution: The Uncomfortable Interface,” 8 (Autumn 1974): 41B75; Michael R. Ash, “The Mormon Myth of Evil Evolution,” 35 (Winter 2002): 19–38; David H. Bailey, “Mormonism and the New Creationism,” 35 (Winter 2002): 39–59; and David H. Bailey, “Scientific Foundations of Mormon Theology,” 21 (Summer 1988): 61–79. See also Trent D. Stephens and D. Jeffrey Meldrum with Forrest B. Peterson, Evolution and Mormonism: A Quest for Understanding (Salt Lake City: Signature Books, 2001); William E. Evenson, “Evolution,” Encyclopedia of Mormonism (New York: Macmillan Publishing, 1992), 2:478; Eldon J. Gardner, “Organic Evolution and the Bible,” in The Search for Harmony: Essays on Science and Mormonism, edited by Gene A. Sessions and Craig J. Oberg (Salt Lake City: Signature Books, 1993); William E. Evenson and Duane E. Jeffery, Mormonism and Evolution: The Authoritative LDS Statements (Salt Lake City: Greg Kofford Books, 2005). 

[3] Christian Illies, “Darwin’s a Priori Insight,” in Darwin and Philosophy, edited by Vittorio Hösle and Christian Illies (Notre Dame, Ind.: University of Notre Dame Press, 2005), 58–82. 

[4] Daniel C. Dennett, Darwin’s Dangerous Idea: Evolution and the Meanings of Life (New York: Simon & Schuster, 1996). 

[5] Kevin N. Laland, John Odling-Smee, Marcus W. Feldman, and Jeremy Kendal, “Conceptual Barriers to Progress within Evolutionary Biology,” Foundations of Science 14, no. 3 (August 2009): 195–216. 

[6] Xenophon, Memorabilia, translated by E. C. Marchant, Loeb Classical Library (Cambridge, Mass.: Harvard University Press, 1923), 57.

[7] Interestingly, President Spencer W. Kimball, “Absolute Truth,” Ensign, September 1978, 3, plays off this idea: “The watchmaker in Switzerland, with materials at hand, made the watch that was found in the sand in a California desert. The people who found the watch had never been to Switzerland, nor seen the watchmaker, nor seen the watch made. The watchmaker still existed, no matter the extent of their ignorance or experience. If the watch had a tongue, it might even lie and say, ‘There is no watchmaker.’ That would not alter the truth.”

[8] Barbara Forrest, “The Wedge at Work: How Intelligent Design Creationism Is Wedging Its Way into the Cultural and Academic Mainstream,” in Intelligent Design Creationism and Its Critics: Philosophical, Theo logical, and Scientific Perspectives, edited by Robert T. Pennock (Cam bridge, Mass.: MIT Press, 2001), 5–53. 

[9] Niels Henrik Gregersen, “Emergence: What Is at Stake for Religious Reflection?” in The Re-Emergence of Emergence, edited by Philip Clayton and Paul Davies (Oxford, England: Oxford University Press, 2006), 279–22. 

[10] Kent C. Condie, “A Premortal Spirits: Implications for Cloning, Abortion, Evolution, and Extinction,” Dialogue: A Journal of Mormon Thought 39 (Spring 2006): 35–56. 

[11] James E. Faulconer, “Divine Embodiment and Transcendence: Propaedeutic Thoughts and Questions,” Element: A Journal of Mormon Philosophy and Theology 1, no. 1 (Spring 2005), http://www.smpt.org/ docs/faulconer_element1-1.html (accessed on July 15, 2009). 

[12] President Gordon B. Hinckley appeared to distance himself from the idea that God was once a man. When asked if Mormons believed that God was once a man, he responded: “I wouldn’t say that. There was a couplet coined, ‘As man is, God once was. As God is, man may become.’ Now that’s more of a couplet than anything else. That gets into some pretty deep theology that we don’t know very much about.” “Musings of the Main Mormon,” Gordon B. Hinckley, interviewed by Don Lattin, San Francisco Chronicle, April 13, 1997, http://www.sfgate.com/cgi-bin/article.cgi?file=/chronicle/archive/1997/04/13/SC36289. DTL (accessed on September 28, 2009). 

[13] Ursula Goodenough, “The Sacred Depths of Nature: Excerpts,” Zygon: Journal of Religion and Science 35, no. 3 (2000): 567–86.

[14] These ideas are found in Joseph Smith, “King Follett Discourse,” http://mldb.byu.edu/follett.htm (accessed October 6, 2009).

[15] Blake T. Ostler, Exploring Mormon Thought: The Attributes of God (Salt Lake City: Greg Kofford Books, 2001), 359–60. 

[16] Neal A. Maxwell, “Patience,” Ensign, October 1980, 28.

[17] James McLachlan, “Fragments for a Process Theology of Mormonism,” Element: A Journal of Mormon Philosophy and Theology 1, no. 2 (Fall 2005), http://www.smpt.org/element.html; Andrew Miles, “Toward a Mormon Metaphysics: Scripture, Process Theology, and the Mechanics of Faith,” Element: A Journal of Mormon Philosophy and Theology 4, no. 1 (Spring 2008); Dan W. Wotherspoon, Awakening Joseph Smith: Mormon Resources for a Postmodern Worldview (Claremont, Calif.: Claremont Graduate University, 1996). 

[18] Gregersen, “Emergence,” 299. 

[19] David N. Livingstone, “Evolution and Religion,” in Evolution: The First Four Billion Years, edited by Michael Ruse and Joseph Travis (Cambridge, Mass.: Belknap Press of Harvard University Press, 2009), 348–69. 

[20] Many interesting responses to evolution from Jewish, Islamic, and Hindu sources posit a personal God who acts in the world. Buddhist responses are less troubled by evolution because of its inherent natural ism. I am not including them in my analysis because Christian responses make an interesting model for creating LDS-compatible theologies, which, like these, must include ideas of the Fall and the Atonement, which are not present in the same ways in non-Christian religions. 

[21] Creationists, including “intelligent design creationists,” sometimes try to distinguish between micro and macro evolutionary processes that biologists do not recognize. Macroevolution refers to the timescale at which evolutionary change is considered and is not a different kind of evolution as is often implied by such groups. For example, it is not uncommon to find people who claim that they believe in microevolution (meaning something like the changes that might be found among different breeds of dogs) but not macroevolution. To a biologist that is the equivalent of claiming “I believe in inches but not miles.”

[22] Gilles Deleuze, “Lecture Course on Chapter Three of Bergson’s Creative Evolution,” Substance: A Review of Theory and Literary Criticism 36, no. 3 (2007): 72–90. 

[23] Michael Vaughan, “Introduction: Henri Bergson’s Creative Evolution,” ibid., 7–24. 

[24] Vitalism was an idea with ancient roots but became prominent during the Enlightenment (seventeenth-eighteenth centuries). Life was made possible by a force not present in non-living things. 

[25] Henri Bergson, Creative Evolution, translated by Arthur Mitchell (1907; New York: Barnes and Noble, 2005), 68; emphasis mine.

[26] Pierre Teilhard de Chardin, The Phenomenon of Man, translated by Bernard Wall, introduction by Julian Huxley (New York: Harper & Row, 1959), 268; emphasis his. 

[27] Ibid., 313. 

[28] See, for example, David R. Griffin, Reenchantment without Supernaturalism: A Process Philosophy of Religion (Cornell, N.Y.: Cornell University Press, 2000); Alfred North Whitehead, Process and Reality (Corrected Edition) (New York: Free Press, 1978). 

[29] John F. Haught, Deeper than Darwin: The Prospect for Religion in the Age of Evolution (Cambridge, Mass.: Westview Press, 2004).

[30] John F. Haught, God after Darwin: A Theology of Evolution (Boulder, Colo.: Westview Press, 2000), 42. 

[31] Arthur Peacocke, “A Naturalistic Christian Faith for the Twenty First Century: An Essay in Interpretation,” in All That Is: A Naturalistic Faith for the Twenty-First Century, edited by Philip Clayton (Minneapolis, Mich.: Fortress Press, 2007), 9. 

[32] Karl E. Peters, “Empirical Theology and a “Naturalistic Chris tian Faith,” in All That Is: A Naturalistic Faith for the Twenty-First Century, edited by Philip Clayton (Minneapolis, Minn.: Fortress Press, 2007), 102. 

[33] Celia Deane-Drummond, Christ and Evolution: Wonder and Wisdom (Theology and the Sciences) (Minneapolis, Minn.: Fortress Press, 2009).

[34] Ibid., 57. 

[35] Pope John Paul II, Truth Cannot Contradict Truth, Address to the Pontifical Academy of Sciences, October 22, 1996, http://www.newadvent.org/library/docs_jp02tc.htm (accessed July 15, 2009). 

[36] Gary James Bergera, “The 1911 Evolution Controversy at Brigham Young University,” in The Search for Harmony: Essays on Science and Mormonism, edited by Gene A. Sessions and Craig J. Oberg (Salt Lake City: Signature Books, 1993), 23–42; James M. McLachlan, “W. H. Chamberlin and the Quest for a Mormon Theology,” Dialogue: A Journal of Mormon Thought 29 (Winter 1996): 151–67; James M. McLachlan, “The Modernism Controversy,” in James M. McLachlan and Loyd Ericson, eds., Dis courses in Mormon Theology: Philosophical & Theological Possibilities (Salt Lake City: Greg Kofford Books, 2007), 39–83. 

[37] William H. Chamberlin, “The Theory of Evolution as an Aid to Faith in God and in the Resurrection,” The White and Blue, February 14, 1911, 4. 

[38] Ralph V. Chamberlin, The Life and Philosophy of W. H. Chamberlin (Salt Lake City: Deseret Book, 1925), 158. 

[39] McLachlan, “Modernism,” 39–83. 

[40] W. H. Chamberlin, “The Life,” 320. 

[41] Ibid., 254. The embedded quotations are from an unpublished essay by W. H. Chamberlin, “Berkeley’s Philosophy of Nature and Modern Theories of Evolution” mentioned in Chamberlin, “The Life,” 250. 

[42] Ibid., 254–55, quoting from an unpublished essay by W. H. Chamberlin, “Berkeley’s Philosophy of Nature and Modern Theories of Evolution,” mentioned in Chamberlin, “The Life,” 250.

[43] Ibid., 255. 

[44] Ibid., 322. 

[45] John A. Widtsoe, Rational Theology (Salt Lake City: Signature Books, 1997), 46–47. 

[46] B. H. Roberts, The Truth, the Way, the Life (Provo, Utah: BYU Studies, 1996), 240. 

[47] Richard Sherlock, “‘We Can See No Advantage to a Continuation of the Discussion’: The Roberts/Smith/Talmage Affair,” Dialogue: A Journal of Mormon Thought 13 (Fall 1980): 63–78; Jeffery, “Seers, Savants, and Evolution,” 41–75. 

[48] Richard Sherlock, “A Turbulent Spectrum: Mormon Reactions to the Darwinist Legacy,” in The Search for Harmony: Essays on Science and Mormonism, edited by Gene A. Sessions and Craig J. Oberg (Salt Lake City: Signature Books, 1993), 69. 

[49] P. Kyle Stanford, Exceeding Our Grasp: Science, History, and the Problem of Unconceived Alternatives (Oxford, England: Oxford University Press, 2006). 

[50] David L. Paulsen, “Joseph Smith and the Problem of Evil,” BYU Studies 39, no. 1 (2000): 53–65. He is quoting Joseph Fielding Smith, comp. and ed., Teachings of the Prophet Joseph Smith (Salt Lake City: Deseret Book, 1974), 181. 

[51] Ibid., 60.

[52] Phillip Kitcher, Living with Darwin: Evolution, Design, and the Future of Faith (Oxford, England: Oxford University Press, 2007), 123.

[53] Ibid., 124. 

[54] Colin McGinn, The Mysterious Flame: Conscious Minds in a Material World (New York: Basic Books, 1999). 

[55] Sheila Taylor, “The Hope for a Universal Salvation,” Element: A Journal of Mormon Philosophy and Theology 2, no. 2 (Fall 2006), http://www.smpt.org/element.html (accessed September 25, 2009).

[56] Illies, “Darwin’s a Priori Insight,” 59, holds that evolution is in fact one of nature’s principles and is a priori true. 

[57] David Hume, Dialogues Concerning Natural Religion (Mineola, N.Y.: Dover, 2006), 35–38. 

[58] Simon Conway Morris, Life’s Solution: Inevitable Humans in a Lonely Universe(Cambridge, England: Cambridge University Press, 2003).

[59] Faulconer, “Divine Embodiment and Transcendence,” 1.

[60] Ibid., 18. 

[61] The First Presidency and Council of the Twelve Apostles of the Church of Jesus Christ of Latter-day Saints, “The Family: A Proclamation to the World” (Salt Lake City: Church of Jesus Christ of Latter-day Saints, 1995), http://www.lds.org/Static%20Files/PDF/Manuals/TheFamily_AProclamationToTheWorld_35538_eng.pdf (accessed September 25, 2009). 

[62] Sarah Blaffer Hrdy, Mother Nature: Maternal Instincts and How They Shape the Human Species (New York: Ballantine Books, 1999).

[63] Joan Roughgarden, Evolution’s Rainbow: Diversity, Gender, and Sexuality in Nature and Humans (Berkeley: University of California Press, 2004).

[64] Joan Roughgarden, The Genial Gene: Deconstructing Darwinian Selfishness (Berkeley: University of California Press, 2009).

[65] Charles Darwin, On the Origin of Species: The Illustrated Edition (New York: Sterling Publishing, 2008), 513. 

[post_title] => Crawling Out of the Primordial Soup: A Step toward the Emergence of an LDS Theology Compatible with Organic Evolution [post_excerpt] => Dialogue 43.1 (Spring 2010): 1–36
And in fact, what might it mean that God “used” evolution tocreate life’s diversity? Was this a choice for God among other al-ternatives? Do Wildman’s pessimistic conclusions hold for Mor-monism? Does evolution imply a noninterventionist Deity? Arethere more optimistic views possible, some of which may actuallysuggest that evolution enhances and expands our view of God? [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => crawling-out-of-the-primordial-soup-a-step-toward-the-emergence-of-an-lds-theology-compatible-with-organic-evolution-2 [to_ping] => [pinged] => [post_modified] => 2024-01-11 00:01:01 [post_modified_gmt] => 2024-01-11 00:01:01 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=9808 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10343 [post_author] => 2147 [post_date] => 2018-03-21 22:37:08 [post_date_gmt] => 2018-03-21 22:37:08 [post_content] =>

Any organism (animal or plant) living on Earth today or any organism that lived on Earth in the geologic past is largely the product of its genes, which in turn are inherited from two parents—or, in the case of asexual reproduction, one parent. No other parents can produce this organism. Hence, if each organism is patterned precisely after a spiritual precursor, as we are commonly led to believe by some interpretations of Moses 3:5, only one set of parents can produce this organism in the temporal world. Carried further, this scenario means that all of our spouses and children are predestined from the spirit world and that we really have not exercised free agency in selecting a mate or in having children in this life. It also means that each plant and animal that has ever lived on Earth was predestined to come from one or two specific parents. This would also seem to require that events in Earth history are predestined, because specific events are necessary to bring predestined individuals into contact with each other in the right time frame. 

But how can a predestined or deterministic temporal world be consistent with traditional LDS belief in free agency? From the very onset of the restoration of the LDS Church, Joseph Smith taught that God "did not elect or predestinate."[1] As Bruce R. McConkie states, "Predestination is the false doctrine that from all eternity God has ordered whatever comes to pass."[2] Determinism advocates that all earthly events are controlled by prior events (usually in the premortal existence), but not necessarily by God. Although L. Rex Sears makes a case for compatibility of free agency and determinism, Blake Ostler shows that his arguments are easily refuted.[3] Also, many basic LDS doctrines are at odds with both predestination and determinism. 

Although free agency and predestination/determinism are generally considered mutually exclusive, LDS teachings and scriptures often do not clarify inconsistencies in these concepts as applied to the preexistence and to God's foreknowledge. In this paper, I examine and explore ways to reconcile inconsistencies by proposing a model for premortal spirits. The viability of the model can be tested against scriptures and scientific observations. If we find factual information that the model cannot explain, then it must be modified or abandoned. The model I propose is that premortal spirits are not predestined for specific mortal bodies, an idea earlier suggested by Frank Salisbury.[4] At present, I know of no evidence, scriptural or scientific, that would require rejecting the model outright. As with scientific models, however, future information may require modification or rejection. 

I also discuss questions about cloning, abortion, evolution, and extinction related to the predestination question. This contribution, however, is not intended to be a discussion of predestination, free agency, or God's foreknowledge, all of which have been discussed from an LDS point of view in recent articles and books, many of which are cited herein. 

The Spiritual Creation: Spirit-Body Relationships 

Many LDS writers have speculated on how spiritual and temporal bodies are related. Most conclude that the earthly body is identical or nearly identical to the spiritual body.[5] Parley P. Pratt was one of the earliest LDS theologians to comment on this subject: "The spirit of man consists of an organization or embodiment of the elements of spiritual matter, in the likeness and after the pattern of the fleshly tabernacle. It possesses, in fact, all the organs and parts exactly corresponding to the outward tabernacle."[6] The most definitive statement is by the First Presidency in 1909: "The spirit of man is in the form of man, and the spirits of all creatures are in the likeness of their bodies."[7] Also, almost all Mormons agree that spirits have gender, a concept most recently stated by President Gordon B. Hinckley in general conference: "All human beings—male and female—are created in the image of God. Each is a beloved spirit son or daughter of heavenly parents, and as such, each has a divine nature and destiny. Gender is an essential characteristic of individual premortal, mortal, and eternal identity and purpose."[8]

However, as discussed by Duane Jeffery and Jeffrey Keller, the gender of an earthly body is not always clearly defined.[9] For instance, what is the gender of spirits who reside in the bodies of hermaphrodites (individuals with male and female sex organs) or in individuals who were males in the preexistence, but in this life have a female body and are raised as females? What about individuals who undergo a sex change? Could it be that some individuals may have a spirit gender different from their temporal gender? 

Premortal Spirits: A Testable Hypothesis 

There may be a way around the predestination problem if the spirits God creates are not predestined for specific organisms. In this case, a premortal spirit is really a nonspecific spirit in that it is not intended for any specific organism but can be placed in any one of many different organisms in a similar taxonomic group at approximately the same degree of complexity within this group. For instance, very simple spirits would be placed in unicellular organisms (like bacteria), while very complex spirits would be placed in mammals. However, because all gradations exist between taxonomic groups, there also must be all gradations between spirits. An important implication of the premortal model is that no premortal spirit, simple, intermediate, or complex, is predestined to be placed in any specific organism. When nonpredestined spirits are placed in embryos of humans they would develop along with the embryo and fetus. These spirits inherit individual mental and spiritual attributes from the intelligences they contain. As a human grows and develops during his or her lifetime, his or her spirit also "grows," at least in terms of mental and spiritual capacities, if not in terms of size and shape. It is now the specific spirit of its host, and only one such organism will ever live on this planet or any place else. For instance, the spirit that was placed in the embryo or fetus that became Joseph Smith was not predestined for Joseph; but once placed in that embryo or fetus, it became the specific and eternal spirit of Joseph Smith. 

We are told in Abraham 5 and in Moses 2 and 3 that God created everything spiritually before it was created temporally. Just what this means, however, is not entirely clear, since the time interval between the two creations is not specified. It could be billions of years or it could be microseconds. In referring to Abraham 3:22-28, Joseph Fielding Smith favored a long time between the two creations: "We were all created untold ages before we were placed on this Earth."[10] However, perhaps not all human spirits were present when the plan of salvation was presented in the preexistence. There are no scriptures to my knowledge that eliminate the possibility that spirits are still being created. We are told that God creates spirits from "intelligences," which have always existed (Abr. 3:22-23; D&C 93:29-30). A minority viewpoint in the LDS Church, as championed by Bruce R. McConkie, who followed Joseph Fielding Smith on this point, is that "the intelligence or spirit element became intelligences after the spirits were born as individual entities."[11] As Joseph Smith taught, however, "Intelligence is eternal and exists upon a self-existent principle."[12] According to B. H. Roberts: 

Intelligences are uncreated entities; some inhabiting spiritual bodies; others are intelligences unembodied in either spirit bodies or other kinds of bodies. They are uncreated, self-existent entities, necessarily self-conscious. . . . They possess powers of comparison and discrimination—they discern between evil and good; between good and better; they possess will or freedom. . . . The individual intelligence can think his own thoughts, act wisely or foolishly; do right or wrong.[13]

Thus, in Roberts's view, intelligences must possess self-consciousness, the power to compare, and the power to chose one thing instead of another. Whether intelligences possess gender, however, is not known. As summarized by Rex Sears: "The God of Mormonism lives in a universe and among intelligences not of his own making. God acquires the ability to predict our behavior only by getting to know us; when meeting an intelligence for the first time, as it were, God does not know if things will work out with that intelligence."[14]

We know very little about how or when spirits were created or whether they are still being created, a fact that has a bearing on the question of predestination. It is a common belief among Mormons that God placed each intelligence in a spirit intended for a specific temporal organ ism as suggested by Doctrine and Covenants 77:2: ". . . that which is spiritual being in the likeness of that which is temporal; and that which is temporal in the likeness of that which is spiritual; the spirit of man in the likeness of his person, as also the spirit of the beast, and every other creature which God has created." This sounds a lot like predestination. 

However, this interpretation is critically dependent upon when the spirits were created. If they were created at or near the time of the temporal creation, it is not surprising that they would have the "likeness" of the organism in which they were to be housed. In this case, predestination is not an issue. But if spirits are created long before their temporal hosts, we are faced again with the predestination question. If we have a large "spirit pool" containing spirits of all forms of life, this would seem to predestine that all these forms of life must appear on Earth. Yet if mortal organisms are the products of evolution, which is a random process (see below), there is no reason that hosts for premortal spirits should have appeared on Earth. This observation strongly implies to me one or both of the following scenarios: (1) most or all spirits were not created eons before the temporal creation but were created at or near the time that their temporal hosts were created; or (2) God creates spirits as generic groups with no one spirit intended for a specific temporal organism. 

Still another question is just how God decides which spirits to place in which mortal bodies. Some human spirits are placed in fetuses with inherited diseases or missing body parts. Some go into children born into rich families. Others go into children born into poor families. Some go into black children, others into white children or other races. Some go into females, others into males, bisexuals, and homosexuals. Some spirits enter bodies that are members of primitive societies, whereas others enter bodies in highly technical societies of the twenty-first century. Clearly not all humans have equal chances of survival or comparably enjoyable lives. Does God discriminate against some spirits and favor others, based perhaps on their performances in the preexistence? 

Although many LDS members believe that our status and the nature of the body we have in this life depend on our performance in the preexistence, I do not share this point of view. The God I believe in is fair and does not purposefully discriminate among spirits. Just how he decides which spirit to place in which body is unknown. One possibility is that he randomly selects spirits or intelligences, thus giving each one an equal chance at where it ends up in this life. A common LDS belief, although not well-supported by scripture, is that the "choicest" spirits are reserved for the latter days. However, this belief again brings up the predestination question—i.e., some spirits are predestined for the latter days. 

Can the idea of nonpredestined premortal spirits be accommodated within LDS doctrine? I think it can; and in the following sections, I test the concept against various LDS scriptures and teachings and explore more fully the ramifications of such an idea.

The Preexistence 

The relationship between the spiritual creation and the temporal creation has a close bearing on the nonpredestined spirit model. There are several interpretations about which scriptures refer to the spiritual creation and which to the temporal creation.[15] Milton R. Hunter, Bruce R. McConkie, and Joseph Fielding Smith interpret Abraham 4-5 as referring to the spiritual creation and Moses 2-3 and Genesis 2 as recording the temporal creation.[16] In contrast, J. Reuben Clark and W. Cleon Skousen read the Moses and Genesis accounts as referring to the spiritual creation, saying little about the temporal creation.[17] Others seem to think that both the spiritual and temporal creations are recorded in Moses and Genesis.[18] Despite these differences, most LDS scripturalists agree on two aspects of the creation accounts: (1) the temporal creation was patterned at least in some degree after the spiritual creation, and (2) all living things were created spiritually before they were created temporally. 

A critical question for the nonpredestined spirit model is just how closely the spiritual creation served as a "blueprint" for the temporal creation. If the correspondence was exact, as some believe,[19] we are again faced with the predestination problem. On the other hand, if the spiritual creation was simply a general outline for the temporal creation or if spirits are created at or immediately before the creation of their temporal hosts, we may be able to sidestep the predestination issue. In either case, I suggest that the spiritual creation was and is the creation of spirits not predestined for a specific temporal home. 

We are told of a great war in the preexistence (D&C 29:36-38; Rev. 12:7), suggesting that at least some part of the spiritual creation preceded the temporal creation. If the great war story is taken at face value, it would appear that approximately one third of the hosts of heaven followed Satan, and thus their spirits will never enter earthly bodies. The other two thirds of the spirits, however, have been or will be placed in earthly bodies. Joseph Smith and other Church presidents made statements suggesting that some human spirits "excelled" in the preexistence and that their placement in a specific terrestrial body reflects, at least in part, their progress in the preexistence.[20]

How does a great war and the progression of spirits in the preexistence constrain the nonpredestined spirit model? If interpreted literally, it implies enough time between the spiritual and temporal creations for at least some humans to have progressed while they were in the spirit world. James E. Talmage also implies this concept.[21] Single spirits, much like single soldiers in an army, have individual differences because they house intelligences with individual differences. Given the opportunity in the premortal spirit world, some spirits may have significantly advanced, while others did not. 

One of the problems with the great war story, however, is that the spirits who followed Christ and elected to take on a temporal body would seem to have been predestined from that time onwards. If evolution is the process by which organisms appeared on Earth, which seems likely (see below), then evolution had to give rise to a very specific group of mortal humans to house these spirits. Given the random nature of evolution, such a scenario is highly improbable. 

One way to get around the predestination problem is if the word "spirit" in the scriptures that refers to premortal existence is misinterpreted. Could these scriptures really be referring to "intelligences," the precursors of spirits? If so, the great war in the preexistence would have occurred before God created spirits. In the same light, it is possible that the progression in the "spirit world" referred to above is really progression in the "intelligence world." There is no obvious reason why progression could not occur in intelligences; in fact, such development would be consistent with the principle of eternal progression, a commonly cited LDS doctrine. 

Foreordination and Foreknowledge 

The nonpredestined spirit model also helps solve problems related to foreordination and foreknowledge. Foreordination, which is a rather unusual LDS teaching, is the concept that certain spirits were called or as signed in the preexistence to carry out certain functions in this lifetime. Doctrine and Covenants 138:55-56 states that many of the "noble and great ones . . . were chosen even before they were born." We can get around the predestination problem with the caveat that, if spirits are fore ordained to fulfill some duty in this life, they can elect not to do so by exercising their free agency.[22] Another factor to be considered is the possibility that some individuals may not be worthy to carry out their foreordained callings. In either case, the spirit is not predestined for a calling in the mortal world. 

If intelligences and spirits can progress in the premortal world, there is no reason that God cannot assign or ask specific intelligences or spirits to perform specific tasks when they arrive in this life.[23] God might pick individual intelligences or spirits that have excelled in certain ways in the preexistence and foreordain them for similar earthly endeavors.[24] However, foreordained intelligences or spirits are not predestined for specific mortal bodies. McConkie argues that God foreordains certain people for certain earthly missions because of the knowledge he has acquired through ages of observation that the person so ordained has the talents and capacities to perform the required task.[25] Perhaps God placed a fore ordained spirit in the embryo that would become Joseph Smith simply because Joseph would be born at the right time and the right place to accomplish the foreordained duties of reestablishing the Church.[26] If Joseph had not met the challenge, however, some other individual of this time period and in this geographic location would have been given that opportunity. 

As with predestination, an absolute foreknowledge of God seems inconsistent with free agency. As nicely summarized by Blake Ostler: "A major problem arises if God foresees precisely what must happen. For if I am morally responsible for an action, I must also be free to refrain from doing that action. But if God knows what my action is before I do it, then it is not genuinely possible for me to do otherwise. If the premises are accepted as sound, then foreknowledge and free agency in the stronger sense of freedom of alternative choices are not logically compatible."[27]

Is the idea that a premortal spirit can be placed in any earthly body (and not predestined for a certain one) inconsistent with the concept that God has a foreknowledge of the future? It would seem to be if God's foreknowledge is absolute. In an LDS context, the question of the degree of God's foreknowledge has been extensively discussed.[28] One interpretation of God's omniscience is that he knows everything that can be known and knows how he will respond to various possibilities in the future but does not have an absolute foreknowledge of the future.[29] His omniscience, however, is not limited by what cannot be known at a given time. Talmage suggests that God's foreknowledge is not absolute and does not necessitate predestination but that "God's foreknowledge is based on intelligence and reason. God foresees the future as a state which naturally and surely will be; but not as one that must be because He has arbitrarily willed that it shall be."[30] B. H. Roberts also suggests that God knows all that is known, which includes all that is or has been, but that he does not know the future in an absolute sense until it arrives.[31] Ostler supports the concept of "existentially contingent omniscience," meaning that God now knows all possibilities but does not know precisely which possibilities will be chosen in the future.[32] For free agency to exist, alternatives in the future must exist. They must be real alternatives and not just "apparent" alternatives as would be the case if God had an absolute foreknowledge. If these interpretations of God's foreknowledge are correct, then premortal spirits are not predestined for a given mortal body nor for a given mortal event. 

Before leaving this topic, it is necessary to mention the philosophy of "timelessness" in respect to God. The idea that God is timeless (in the sense that for God there is no past, present, or future) has been discussed by both Robson and Ostler.[33] Although a few, Elder Neal A. Maxwell among them, seem to accept a timeless God,[34] many scriptures clearly indicate that God cannot be timeless, a fact superbly summarized by Robson and Ostler.[35] I accept these arguments and, for the purposes of this discussion, do not consider a timeless God as a viable alternative. 

Premortal Appearances of Christ 

One of the most difficult challenges to the nonpredestined spirit model of the preexistence is abundant scriptural references to Christ's manifestations before his mortal birth. Although Christ (Jehovah) spoke to one or more people prior to his birth (e.g., Moses 1:2; Abr. 2:6-11; 3:11), he appeared in person relatively infrequently. One well-documented incident is his appearance to Mahonri Moriancumer, the brother of Jared: "Behold, this body, which ye now behold, is the body of my spirit; and man have I created after the body of my spirit; and even as I appear unto thee to be in the spirit will I appear unto my people in the flesh" (Eth. 3:16). 

How do these premortal appearances of Christ avoid the problem of predestination? If the voice of Jehovah in the Old Testament was indeed that of Christ and if his appearances were in his "mortal form," then the spirit of Christ must have been predestined to enter Christ's mortal body. Romans 8:29-30 suggests that God created Christ's spirit to enter a very specific human being: 

For whom he did foreknow, he also did predestinate to be conformed to the image of his Son, that he might be the firstborn among many brethren. 

Moreover whom he did predestinate, them he also called: and whom he called, them he also justified: and whom he justified, them he also glorified. (Emphasis mine; see also D&C 93:21; 2 Tim. 1:9.) 

If these scriptures are interpreted literally, they imply that the spirit of Christ had the same voice and appearance as the mortal Christ long before there was a mortal Christ. 

I can see two ways around this problem that preserve the nonpredestined spirit model for most humans: (1) Christ was different from everyone else—he really was predestined for a certain mortal body; or (2) it was not Christ (Jehovah) who appeared in the Old Testament. The easiest way around the predestination problem is that it applies to everyone except Christ. Certainly Christ is a unique individual in many other ways: having God as a father yet an earthly (perhaps surrogate) mother; showing great leadership capacity in the preexistence (John 17:5); being the only person free from sin; and finally, being the Savior of all humankind. Why not add another exception to the list? In fact, the scripture quoted from Romans specifically states that Christ's spirit was predestined. Perhaps God created a spirit for Christ that could appear and speak to earthly inhabitants with a spirit body identical to the mortal body, which would appear in the future. This also implies that Christ's spirit body, which appeared as an adult to the brother of Jared, could return to some nascent state with a very small size before entering the mortal embryo Christ at a later time. 

One problem with this idea emerges if Christ is really half mortal—if half his genes came from Mary. This would seem to predestine Mary to be his mother, which in turn would predestine many events that resulted in Mary being born at the right period of time and in the right place—in short, also predestinating her ancestors. It would seem that the only way around this problem is to have all of Christ's genes come from God and an eternal mother, and none from Mary. This scenario, however, relegates Mary to the role of a surrogate mother, not Christ's biological mother. 

Alternatively, the images and voices of Jehovah described in the Old Testament may not have been those of Christ. Rather, God may have im printed in the brains of Old Testament people the image (or/and voice) of a man similar to the way Christ would look or sound as a mortal. It makes no difference in terms of the lessons taught to Old Testament people whether it was really Jehovah's spirit talking to them or some other male voice. This alternative, however, requires that God deceived the individuals in the Old Testament who believed they were hearing or seeing Jehovah. 

Cloning 

The nonpredestined spirit model may solve doctrinal problems raised by cloning. Cloning is the production of a group of identical cells or organisms that come from a single organism. The genetic "parent" of Dolly, the cloned sheep in Scotland, was the nucleus from a single adult mammary gland cell.[36] Cloning is not new but has been used since the 1970s to produce cattle for breeding.[37] One potential use of cloning is to make human "replacements" for old people or dying relatives, or to make many copies of one's children. Cloning can also be a valuable tool in studying human development, genetically modifying embryos, and developing new organ transplant methods.[38]

Humans can be cloned in at least two ways: (1) split an embryo into several segments, and new individuals develop from each segment—this is the natural method that produces identical twins—and (2) clone cells from a human, thus producing individuals identical to that human. Every cell contains the genetic information to make an entire human being. On December 14, 1998, South Korean scientists of the Seoul Fertility Clinic announced that they had cloned a human embryo.[39] They claim to have inserted a new nucleus in a human egg cell and activated the cell, which reportedly divided twice in vitro before the researchers terminated the experiment. This claim immediately set off a wave of scientific doubt and controversy. Regardless of the outcome of this claim, we are close to the time when a human embryo will be cloned. 

Most Christian religions believe in a human soul (spirit + body = soul; D&C 88:15), which brings up the question of whether it is possible to clone the soul. If a person's physical body can be cloned, but not his or her soul, what does this mean for the clone's eternal future? The only official statement of the LDS Church on cloning is ambiguous and not widely available to the general public.[40]

It is interesting to explore some of the ramifications of cloning in light of nonpredestined spirits. I can see no reason why God would refuse to place spirits in human clones and, as with any other human, each clone plus its spirit (i.e., a soul) becomes a specific human being. Although the clone would be anatomically identical or at least very similar to its single "parent," its mental and spiritual qualities could become quite different depending on various environmental factors affecting the clone during its lifetime. Also contributing to divergence from the original organism are different cytoplasm and mitochondria in the clone. We can consider God as the creator of spirits while scientists, by using genetics, could play an important role in controlling and designing the mortal bodies into which some of these spirits are placed. I do not have a problem with this idea. In fact, God may be waiting for us to develop bodies by genetic engineering or cloning to house more advanced or complex spirits that he will create. 

Can scientists clone spirits? Of course, we do not have an answer to this question since science cannot detect, identify, or even validate the existence of spirits. However, in the context of LDS doctrine, it seems that God reserves all manipulations of spirits for himself. There are probably enough intelligences or/and premortal spirits that each human-made clone can have its own God-made spirit. 

What about unicellular organisms that propagate by cell division? When a cell divides, perhaps its spirit divides also, or alternatively, God may place a new spirit in one or both of the derivative cells. 

Abortion 

Perhaps no other moral issue divides the American public more than abortion. In part, the controversy hinges on the question of when the spirit enters the body. If a spirit were predestined for a given mortal body and that body is aborted before birth, the spirit would, technically, never be able to have a mortal existence. However, in the nonpredestined scenario, abortion prior to the time the spirit enters the fetus simply means that the spirit would be assigned to another fetus. Thus, the abortion would not prevent this spirit from acquiring a body but would simply transfer it to another fetus prior to birth. Brigham Young carried this idea even further when he stated: "When some people have little children born at 6 & 7 months pregnancy and they live but a few hours then die, they bless them etc. but I don't do it for I think . . . that such a spirit will have a chance of occupying another tabernacle and developing itself."[41] Although this idea does not require that the spirits are not predestined for their first body, it is certainly consistent with this possibility, thus giving them another chance at life. 

Just when the spirit enters the body is the subject of considerable interest and discussion as reviewed by Lester Bush and Jeffrey Keller.[42] Consider three scenarios: (1) the spirit enters at conception, (2) the spirit enters at birth, or (3) the spirit enters sometime between conception and birth. In the nonpredestined spirit model, if a spirit enters the embryo at conception, then clearly abortion at any time will prevent it from having a second chance to acquire a body. However, if a spirit enters at birth, abortion could result in reassignment of the spirit to another body, provided that the spirit was not predestined for the aborted fetus. The same argument can be used for any abortion, provided it occurs before the spirit enters the body. If Brigham Young is right, some spirits may have a second chance at life if they are born prematurely the first time around. This idea, however, is not consistent with the nonpredestined spirit model, if spirits are placed in the fetuses before the premature births. 

There appear to be no unambiguous scriptures or statements by LDS prophets about when the spirit enters the body.[43] However, the official stand of the LDS Church on abortion allows us to infer an answer. Except for rape, incest, endangering the mother's life, or fatal defects in the fetus, the LDS Church has taken a very strong stand against abortion at any stage during fetal development.[44] Does this imply that the spirit enters the embryo at the time of conception? If so, it would suggest that, at the time spirits enter the embryo, they are very small (assuming they have a size) and that perhaps they grow along with the mortal body through its lifetime. However, if spirits enter the embryo at conception, what happens to this embryo if it is later cloned, if it fuses with another embryo, or if its genes are modified? Is the spirit also cloned or fused; and if so, are there some organisms with half spirits or multiple spirits (in the case of embryo fission or fusion)? 

This scenario sounds improbable and seems to imply that spirits do not enter embryos until the embryos have developed beyond the stage that geneticists can modify them, or several weeks after conception. Also supporting this idea is the fact that 30-40 percent of human embryos are spontaneously aborted, chiefly in the first few weeks after conception. If spirits were already in these embryos, this would terminate their "life" before birth, thus discriminating against or perhaps favoring these individuals, depending on what happens to these spirits after death. In any case, unless they are recycled into another body, they are deprived of an earthly life. 

Organic Evolution 

The nonpredestined spirit model also resolves doctrinal problems related to organic evolution. Although not everyone accepts it, the evidence that life on this planet has developed by organic evolution is overwhelming.[45] No longer must we rely on a few poorly preserved fossils, for we now have a vast fossil record with many of the so-called missing links identified, and more being identified every day.[46] To complement and support the fossil record, we have evidence from genetics, DNA biochemistry, and anthropology, all of which strongly support evolution as the mechanism by which life (including human life) has developed on Earth.[47] Fortunately, it is not necessary to consider evolution and Chris tian doctrine for the origin of humans as incompatible. Kenneth Miller summarizes nicely: "Evolution was much more than an indirect pathway to get you and me. By choosing evolution as His way to fashion the living world, [God] emphasized our material nature and our unity with other forms of life. He made the world today contingent upon the events of the past. He made our choices matter, our actions genuine, our lives important. In the final analysis, He used evolution as the tool to set us free."[48]

Furthermore, LDS doctrine has the concept of eternal progression, and evolution can be considered as one example of eternal progression. Although officially the LDS Church takes no stand on organic evolution,[49] there are different viewpoints on whether evolution and LDS doctrine are compatible.[50] It is not my purpose here to summarize the vast evidence for organic evolution. As a scientist, I accept evolution as the process by which humans eventually appeared on Earth. My purpose here is to explore the significance of evolution in terms of the nonpredestined spirit model. 

In studying the fossil record over the last four billion years we see an overall progression of organisms from simple unicellular types to a great variety of complex animals and plants. Actually, the origin of humans should be considered as a process, not an event. Humans as such (the genus Homo) appeared about two million years ago in East Africa and spread to Asia and Europe soon after this time. The combined results of studies of fossil humans, genetics, and DNA indicate that Homo sapiens appeared about 195,000 years ago, when African and non-African linguistic and genetic lines separated somewhere in eastern Africa.[51] By at least 100,000 years ago, humans had moved into Asia and Australia, and sometime between 20,000 and 35,000 years ago, they had moved into Europe and the Americas. Prior to the appearance of Homo sapiens, human ancestral forms such as Australopithecus were widespread in Africa. Just how do all these hominids fit into the creation of human beings? 

One of the problems in making humans by evolution is the randomness that characterizes evolution, as Carl Sagan emphasizes: "Even if life on another planet has the same molecular chemistry as life here, there is no reason to expect it to resemble familiar organisms. . . . In general the random character of the evolutionary process should create extraterrestrial creatures very different from any that we know."[52] Hence, humans are not a necessary product of evolution. 

What does this mean for the LDS belief that humans are created in God's image? Some Christian religions avoid the problem by assuming that "image" does not mean physical image but only that our "hearts and minds are fashioned in the likeness of God."[53] Some scientists point out that genetics and selection are only two of the forces directing evolution; furthermore, the final organisms are constrained by mechanical factors controlled by laws of physics. In this case, God may have "plenty of room to operate with predictability within evolution's bounded variation."[54] Still another possibility that cannot be disproved by science is that mutations are not always random. Perhaps on occasion, God directs mutations to ensure that one evolutionary line eventually leads to humans. This occasional tweaking of the genes by God may not be recognizable in the fossil record. If this is the case, life forms that evolve on another planet may be quite different from those on Earth, as Sagan hypothesizes, but humans could still appear through an evolutionary line closely monitored and directed by God. 

As life has evolved on Earth during the past four billion years, God may have created increasingly complex spirits to enter the evolving mortal hosts without, according to my argument, any specific spirit being predestined for a specific organism. In a very general way, spirits of one degree of complexity are placed in organisms of similar taxonomy and complexity. However, because evolution produces all gradations between taxonomic groups, there also must be all gradations of taxonomy and complexity among spirits. One group of complex spirits would enter individuals in the evolutionary chain of hominins (primitive hominids and humans). According to my hypothesis, God created the most complex and highly developed spirits of this group for the bodies of Homo sapiens. 

But what if humans continue to evolve and their descendants do not look much like present-day humans? One appealing aspect of the nonpredestined spirit model for evolution is its flexibility. As new hominins evolve, perhaps by cloning and genetic engineering, God may create appropriate spirits for these individuals. Perhaps even a different species of Homo will appear in the future through the efforts of genetic engineering and cloning. 

Still another question related to evolution is that of how God acquired his physical body. As taught by Joseph Smith in the King Foiled: discourse, "[Godl was once a man like one of us and God himself, the Father of us all, once dwelled on an Earth the same as Jesus Christ himself did in the flesh and like us."[55] This statement implies that God acquired his body by a process of evolution—the same way humans acquire their bodies. Does this mean that there was another God at the time "our God" was going through his planetary existence? This idea is consistent with Joseph Smith's teachings on the "multiplicity of Gods." Furthermore, if our God created the universe with a big bang some 13.7 billion years ago, there must have been other universes, perhaps one God for each universe. In fact some cosmologists today consider the possibility of multiple universes to lie well within the province of scientific reality.[56]

Extinctions 

It is well known that many organisms have become extinct, some in the geologic past as recorded by the fossil record, and some very recently due directly or indirectly to the impact of humans.[57] Some extinctions in volve single species, such as the dodo bird, the passenger pigeon, and the elephant bird, all of which have become extinct in the last two hundred years. Others involve many life forms and are referred to as mass extinctions, with many species from different ecological environments becoming extinct within short periods of time. An important example is at the Cretaceous/Tertiary (K/T) boundary 65 million years ago when more than two hundred animal families became extinct, probably resulting from an asteroid impact.[58] A second example occurred at the end of the Permian 250 million years ago, when more than three hundred animal families disappeared due to a combination of geologic and climatic changes at this time. Some groups, such as the dinosaurs at the K/T boundary, disappeared entirely during a mass extinction, although their relatives, the birds, survived. 

Extinction brings up an important question: When an organism or a group of organisms becomes extinct, how does their disappearance constrain the timing of the creation of the spirits of these organisms? If these spirits were created long before the organisms appeared on Earth, what happens to them when their earthly hosts are no longer being produced? One possibility is that the spirits intended for extinct organisms "skip" a mortal existence and directly acquire an eternal body. If this is the case, however, why is a mortal existence necessary at all for any organisms? 

A more plausible possibility, I argue, is that God creates spirits for many (or all) of His "worlds" and places them in one gigantic "spirit pool" to be used as needed. In this case, if a group of organisms becomes extinct on one planet, their previously created spirits can be used on another planet in some other part of the universe. Although we cannot eliminate this possibility, I know of no scriptural evidence to support it, and evolution, as a random process, would not necessarily produce terrestrial organisms on another planet. To me the most obvious answer to this problem is provided by the nonpredestined spirit model. God does not create spirits until just before their mortal creation, with the possible exception of the human spirits who participated in the war in heaven. If spirits are created by God as needed and placed in mortal organisms, there is no residual "spirit pool" for organisms that become extinct and no predestination. 

Conclusions 

The LDS concept of a spiritual creation may predestine spirits to specific mortal organisms, thus challenging the principle of free agency. The predestination problem, however, can be avoided if the spirits that God creates are not predestined to specific organisms. Instead, premortal spirits are not intended for any specific organism but can be placed in any one of many different organisms. However, because all gradations exist between taxonomic groups, there also must be all gradations between spirits. The common idea that the spiritual creation was a blueprint of the temporal creation must be modified to avoid predestination. This adjustment can be easily made by seeing the spiritual blueprint as a very crude outline, rather than as an exact rendering of the final product. Still another way around the predestination problem would be that spirits are created at or immediately before the creation of their temporal hosts. 

Nonpredestined spirits can be foreordained, but foreordained spirits are not predestined for specific mortal bodies. The premortal appearances of Christ strongly suggest that Christ is an exception and that he really was predestined for a certain mortal body. To avoid the predestination of Mary and her ancestors, however, she must be the surrogate mother, not the biologic mother of Christ. 

There is no reason that God should not create spirits for clones. Premortal spirits placed in human clones produce a human that develops into a specific individual just like a nonclone. In the future, geneticists may play an ever-increasing role in controlling and designing some human bodies, but only God can create the spirits that go into these bodies. In terms of the nonpredestined spirit model, if abortion is performed prior to the time the spirit enters the fetus, this spirit could be placed in another fetus, and there is no problem with predestination. The great unknown is when the spirit actually enters the body. 

If mortal organisms are the products of evolution, which is a random process, there is no reason that appropriate hosts for previously created spirits should appear on Earth. This conclusion strongly implies that most or all spirits were not created eons before the temporal creation but were created at or near the time that their temporal hosts were created, or/and that God creates spirits as generic groups with n o one spirit intended for a specific temporal organism. To ensure that humans, patterned after God's image, appear in one evolutionary line, Go d may direct some mutations. Occasional tweaking of the genes by God may not be recognizable in the fossil record. However, no spirit is predestined for a specific organism; rather, spirits of a given complexity are placed in organisms of similar taxonomy and degree of complexity. Extinctions in the geologic record avoid the predestination problem if God creates spirits as needed and places them in mortal organisms. This way there is no residual "spirit pool" for organisms that become extinct and no predestination. 

A nonpredestined spiritual creation provides important insights into the well-established conflict between predestination and free agency, yet it preserves the individual as the distinct entity it was when it coexisted with God as an intelligence. 

---

[1] Times and Seasons, 2 (June 1, 1841): 429-30; Joseph Smith Jr. et al., History of the Church of Jesus Christ of Latter-day Saints, edited by B. H. Roberts, 2d ed. rev., 7 vols. (Salt Lake City: Deseret News Press, 1902-12, Vol. 7 published 1932; 1976 printing), 4:358-60. 

[2] Bruce R. McConkie, Mormon Doctrine, 2d. ed. (Salt Lake City: Bookcraft, 1966), 588. 

[3] L. Rex Sears, "Determinist Mansions in the Mormon House?" Dialogue: A Journal of Mormon Thought 31, no. 4 (Winter 1998): 115-41; Blake T. Ostler, "Mormonism and Determinism," Dialogue: A Journal of Mormon Thought 32, no. 4 (Winter 1999): 51. 

[4] Frank B. Salisbury, "Genetics and Some Gospel Concepts," The Instructor, November 1965, 437. 

[5] Charles W Penrose, November 16, 1884, Journal of Discourses, 26 vols. (London and Liverpool: LDS Booksellers Depot, 1855-86), 26:21; Mark E. Petersen and Emma Marr Petersen, Virtue Makes Sense! (Salt Lake City: Deseret Book, 1976), 15; Joseph Fielding Smith, Man: His Origin and Destiny (Salt Lake City: Deseret Book, 1954), 352; James E. Talmage, "The Earth and Man," The Instructor, December 1965, 477. 

[6] Parley P. Pratt, Key to the Science of Theology (Salt Lake City: Deseret Book, 1893, fifth printing), 119. 

[7] LDS Church First Presidency, "The Origin of Man," Improvement Era 13 (November 1909): 78. The First Presidency then consisted of Joseph F. Smith, John R. Winder, and Anthon H. Lund. 

[8] Gordon B. Hinckley, "Stand Strong against the Wiles of the World," Ensign, November 1995, 102. 

[9] Duane E. Jeffery, "Intersexes in Humans: An Introductory Exploration," Dialogue: A Journal of Mormon Thought 12, no. 3 (Autumn 1979): 107; Jeffrey E. Keller, "Question: Is Sexual Gender Eternal?" Sunstone 10, no. 11 (1985): 38. 

[10] Joseph Fielding Smith, Doctrines of Salvation, compiled by Bruce R. McConkie, 3 vols. (Salt Lake City: Bookcraft, 1954), 1:76. 

[11] McConkie, Mormon Doctrine, 387; emphasis mine. 

[12] Joseph Fielding Smith, ed. and comp., Teachings of the Prophet Joseph Smith (Salt Lake City: Deseret Book, 1979), 353-54. 

[13] B. H. Roberts, The Truth, the Way, the Life: An Elementary Treatise on Theology (San Francisco: Smith Research Associates, 1994), 287. 

[14] Sears, "Determinist Mansions in the Mormon House?" 141; emphasis mine. 

[15] For an excellent review, see Blake T. Ostler, "The Idea of Preexistence in the Development of Mormon Thought," Dialogue: A Journal of Mormon Thought 15, no. 1 (Spring 1982): 59. 

[16] Milton R. Hunter, Pearl of Great Price Commentary (Salt Lake City: Stevens & Wallis, 1948), 74; McConkie, Mormon Doctrine, 170; Joseph Fielding Smith, Doctrines of Salvation, 1:75-76. 

[17] J. Reuben Clark Jr., Church News, December 29, 1956, 10; W Cleon Skousen, The First 2000 Years (Salt Lake City: Bookcraft, 1953), 19.

[18] Hyrum L. Andrus, Doctrinal Commentary on the Pearl of Great Price (Salt Lake City: Deseret Book, 1967), 138-41.

[19] James E. Talmage, The Articles of Faith (Salt Lake City: Church of Jesus Christ of Latter-day Saints, 1975), 189-94. 

[20] McConkie, Mormon Doctrine, 290-92. 

[21] Talmage, The Articles of Faith, 189-94. 

[22] McConkie, Mormon Doctrine, 290-92; Daniel H. Ludlow, A Companion to Your Study of the Doctrine and Covenants (Salt Lake City: Deseret Book, 1978), 98; Sears, "Determinist Mansions in the Mormon House?" 126-27. 

[23] Sears, "Determinist Mansions in the Mormon House?" 141. 

[24] Joseph Fielding Smith, Teachings of the Prophet Joseph Smith, 365.

[25] McConkie, Mormon Doctrine, 290-92. 

[26] Joseph Fielding Smith, Teachings of the Prophet Joseph Smith, 365.

[27] Blake T. Ostler, "The Mormon Concept of God," Dialogue: A Journal of Mormon Thought 17, no. 2 (Summer 1984): 69; see also Ostler, Exploring Mormon Thought: The Attributes of God (Salt Lake City: Greg Kofford Books, 2001).

[28] James E. Talmage, Jesus the Christ (Salt Lake City: Church of Jesus Christ of Latter-day Saints, 1962), 28-29; Roberts, The Truth, the Way, the Life, 477-78; Kent E. Robson, "Time and Omniscience in Mormon Theology," Sunstone 5, no. 3 (1980): 17; David H. Bailey, "Mormons and the Omnis: The Dangers of Theological Speculation," Dialogue: A Journal of Mormon Thought 37, no. 3 (Fall 2004): 41; R. Dennis Potter, "What Does God Write in His Franklin Planner? The Paradoxes of Providence, Prophecy, and Petitionary Prayer," Dialogue: A Journal of Mormon Thought 37, no. 3 (Fall 2004): 51-55. 

[29] Ostler, "Mormonism and Determinism"; Robson, "Time and Omni science in Mormon Theology," 17. 

[30] Talmage, Jesus the Christ, 28-29; emphasis mine. Robson, "Time and Omniscience in Mormon Theology," 17, also argues for this position.

[31] Roberts, The Truth, the Way, the Life, 477-78. 

[32] Ostler, "The Mormon Concept of God," 71; Ostler, Exploring Mormon Thought, chap. 10. 

[33] Robson, "Time and Omniscience in Mormon Theology," 17; Ostler, Exploring Mormon Thought, chap. 11. 

[34] Neal A. Maxwell, Ail These Things Shall Give Thee Experience (Salt Lake City: Deseret Book, 1979), 37. 

[35] Robson, "Time and Omniscience in Mormon Theology," 17; Ostler, Exploring Mormon Thought, chap. 11. 

[36] K. H. S. Campbell, J. McWhir, W. A. Ritchie, and I. Wilmut, "Sheep Cloned by Nuclear Transfer from a Cultured Cell Line," Nature 380 (March 7, 1996): 810-13. 

[37] G. B. Anderson and G. E Seidel, "Cloning for Profit," Science 280 (May 29, 1998): 1400-1401. 

[38] I. Wilmut, "Cloning for Medicine," Scientific American, December 1998, 58-63. See also related documents on the National Human Genome Research Institute website, http://www.genome.gov. 

[39] M. Baker, "Korean Report Sparks Anger and Inquiry," Science 283 (January 1, 1999): 16-17. 

[40] Don LeFevre, Church Public Communications, March 21, 1997, quoted in Courtney Campbell, "Prophecy and Citizenry: The Case of Human Cloning," Sunstone 21, no. 2 (1998): 14. 

[41] Quoted in Wilford Woodruff, Wilford Woodruff s Journal, 1833-1898, typescript, edited by Scott G. Kenny, 9 vols. (Midvale, Utah: Signature Books, 1983-85), 5:66. 

[42] Lester E. Bush, "Ethical Issues in Reproductive Medicine: A Mormon Perspective," Dialogue: A Journal of Mormon Thought 18, no. 2 (Summer 1985): 41; Jeffrey E. Keller, "When Does the Spirit Enter the Body?" Sunstone 10, no. 2 (1985): 42. 

[43] Keller, "When Does the Spirit Enter the Body?" 42-44. 

[44] Gordon B. Hinckley, "What Are People Asking about Us?" Ensign, November 1998, 70-72. 

[45] Kenneth R. Miller, Finding Darwin's God (New York: Harper-Collins, 1999). 

[46] Kent C. Condie and Robert E. Sloan, Origin and Evolution of Earth (Upper Saddle River, NJ.: Prentice-Hall, 1998); Ian Tattersall, Becoming Human: Evolution and Human Uniqueness (New York: Harcourt Brace, 1998); Bernard G. Campbell, Human Evolution: An Introduction to Man's Adaptations, 4th ed. (Hawthorne, N.Y.: Aldine de Gruyter, 1998); Trent D. Stephens and D. Jeffrey Meldrum, Evolution and Mormonism: A Quest for Understanding (Salt Lake City: Signature Books, 2001). 

[47] Scott Freeman and Jon C. Herron, Evolutionary Analysis, 3rd ed. (Upper Saddle River, N.J.: Prentice-Hall, 2004); Ernst Mayer, What Evolution Is (New York: Basic Books, 2001); Luigi Luca Cavalli-Sforza, Paolo Menozzi, and Alberto Piazza, The History and Geography of Human Genes (Princeton, N.J.: Princeton University Press, 1994). 

[48] Miller, Finding Darwin's God, 253. 

[49] William L. Stokes, "An Official Position," Dialogue: A Journal of Mormon Thought 12, no. 4 (Winter 1979): 90-92. The "official position" is that there isn't one. 

[50] Stephens and Meldrum, Evolution and Mormonism; Duane E. Jeffery, "Seers, Savants and Evolution: The Uncomfortable Interface," Dialogue: A Journal of Mormon Thought 8, nos. 3-4 (Autumn/Winter 1974): 41; Stephen and Kathy Snow, Dow Woodward, N. L. Eatongh, and Duane E. Jeffery, "Seers, Savants and Evolution: A Continuing Dialogue," Dialogue: A Journal of Mormon Thought 9, no. 3 (Autumn 1974): 21.

[51] Condie and Sloan, Origin and Evolution of Earth; Tattersall, Becoming Human: Evolution and Human Uniqueness; Campbell, Human Evolution; I. McDoug all, F. H. Brown, and J. G. Fleagle, "Stratigraphic Placement and Age of Modern Humans from Kibish, Ethiopia," Nature 433 (February 17, 2005): 733-36. 

[52] Carl Sagan, Cosmos (New York: Random House, 1980), 284.

[53] Miller, Finding Darwin's God, 275. 

[54] Stephens and Meldrum, Evolution and Mormonism, 200. 

[55] Stan Larson, "The King Follett Discourse: A Newly Amalgamated Text," BYU Studies 18, no. 2 (1978): 201. 

[56] M. Rees, Just Six Numbers (New York: Basic Books, 2000), 166-71.

[57] Condie and Sloan, Origin and Evolution of Earth; Tattersall, Becoming Human; Campbell, Human Evolution. 

[58] Condie and Sloan, Origin and Evolution of Earth, 371.

[post_title] => Premortal Spirits: Implications for Cloning, Abortion, Evolution, and Extinction [post_excerpt] => Dialogue 39.1 (Spring 2006): 1–18
Perhaps no other moral issue divides the American public more than abortion. In part, the controversy hinges on the question of when the spirit enters the body. If a spirit were predestined for a given mortalbody and that body is aborted before birth, the spirit would, technically,never be able to have a mortal existence. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => premortal-spirits-implications-for-cloning-abortion-evolution-and-extinction [to_ping] => [pinged] => [post_modified] => 2024-01-11 00:44:38 [post_modified_gmt] => 2024-01-11 00:44:38 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10343 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10714 [post_author] => 2293 [post_date] => 2018-08-26 01:43:19 [post_date_gmt] => 2018-08-26 01:43:19 [post_content] =>

Religious doctrines would do well to withdraw their pretension to be dealing with matters of fact. That pretension. . .is the source of the conflicts of religion with science. . . .When [religion] seeks its sanctions in the sphere of reality, [it] forgets that its proper concern is to express the ideal. .. .The excellence of religion is due to the idealization of experience which, while making religion noble if treated as poetry, makes it necessarily false if treated as science. 

George Santayana[1]

A claim is frequently made that science and religion are not incompatible. The contention is that science and religion can be made to co-exist by compartmentalization, that is, by carefully limiting the scope of each so that neither intrudes on the sphere of influence of the other. Such an approach is folly. Both science and religion claim to be comprehensive and exclusive views of the world. Both make assertions about things that are generally claimed to be within the province of the other discipline. The primary example of such encroachment lies in the question of whether or not there is a God. If either science or religion is constrained to any such arbitrary limitation of scope, it bridles at the restriction and refuses to accept the boundaries of the separation. If science is taken to be Knowledge (investigatable, verifiable, repeatable, etc.) and religion is taken to be Meaning (purpose, values, morality, etc.)—limited definitions and assumptions not happily accepted by either—then science may not be permitted to talk about the "meaning of life" in drawing conclusions about mankind, cosmology, and evolution; likewise, religion may not be permitted to talk about creation or to argue that the knowledge of life, of our existence and history, is bound up with God's plan and man's struggle with good and evil. I think these kinds of limitations are generally unacceptable to both science and religion. And you will note that some areas of major contention, such as history, man's nature, the future, etc., are not mentioned here as belonging to one or the other because they have been the source of heightened and bitter turf conflict over the centuries. 

The late Stephen J. Gould, paleontologist, evolutionary biologist, and brilliant essayist, attempts a compartmentalization of science and religion in his book Rocks of Ages: Science and Religion in the Fullness of Life. He proposes that the communities of science and religion adopt the principle of NOMA (non overlapping magisteria), in which both scrupulously observe the boundaries of their spheres of influence and leave us a world free of turmoil. "People of good will wish to see science and religion at peace. . . . I do not see how science and religion could be unified, or even synthesized, under any common scheme of explanation or analysis; but I also do not understand why the two enterprises should experience any conflict."[2] Gould's position is a thoughtful one, but ultimately it founders on the hard heads of those in both communities who refuse to observe the boundaries. In truth, it goes against human psychology to maintain two systems. We want a single view of the world, and there will always be those in both communities, not as wise or tolerant as Gould, who assert the primacy of their view over all others. The important part of Gould's statement above is that he sees no ground for a unification or synthesis of the two views. The conflict of science and religion is a serious problem that cannot be ignored because both systems of thought present ideas about the same problems and those ideas inevitably lead to conflict and misunderstandings of both scientific theory and of religious belief. 

The sage Hugh W. Nibley once remarked that "Being expert neither in science nor religion, we are relieved of the responsibility of discussing a theme whose treatment has suffered from everything but neglect."[3] This essay will add to that suffering but will not attempt a reconciliation of the two points of view. It will not discuss religion as a system of knowledge. In part, that is because most Dialogue readers already understand the basis of religious knowledge—faith, revelation, scripture, personal witness, prophetic statements, etc. The other part of that limitation is that such a treatment of religious epistemology doesn't lend itself to scientific analysis. Religion is based on faith, not on facts. This essay attempts to evaluate the current state of affairs between the competing realms of science and religion when religion is expressed to some degree as anti-science. While this essay addresses the conflict between science and religion, the underlying question is really one of science or anti-science. I recognize that religion is not the same as anti-science and that religion is not limited to anti-science; religion, nevertheless, poses a major challenge to the scientific way of thinking and working. Religious sources of knowledge are unscientific in that they are not verifiable, repeatable, or accessible to scientific experiment, and religious knowledge is not correlated to other branches of knowledge. With those differences are included many of the religious conclusions about science and the world that are drawn from that specific religious knowledge. Sterling McMurrin said it well: "Religion is not science. . .it is not essentially a body of ideas and should not suffer the fate of being categorized, analyzed, generalized, and systematized. It is an experience of the numinous, a confrontation of the divine mystery, an ultimate concern and commitment."[4] But, religion is specifically anti-scientific when it asserts conclusions and methodologies that are contrary to events or principles that have been or can be investigated in a scientific manner. 

McMurrin's careful distinction poses a further problem for organized religion. If, as he asserts, religion is a fundamentally individual experience of faith and commitment rather than an exercise in study, intellectualization, collective history, and/or living in a real-world community, what then is the basis on which religious community and authority are established? In other words, how does private belief or experience translate into public real world living? A community based on religion almost invariably proposes that some members, for example Joseph Smith and successive prophets, have superior gifts of discernment, and the authority to rule the community derives from the superiority of those gifts. The religious community collectively accepts the commitment to rules of behavior in its adherence to that authority. If McMurrin is right, then leadership authority generalizes a private view to the community, and therein lies the problem. If religion is only a personal experience, not subject to real-world conditions, then there is no public authority and no basis for practical community. Religion can't have it both ways: either it is only a personal, private experience beyond scientific analysis, or it is a worldly phenomenon subject to the scrutiny of worldly analysis. If members of the religious community are asked to do this or that "because God has revealed it to be this way," then it becomes a matter of examining whether it really is this or that way. 

It is worth noting that some religions, generally liberal Protestant ones, have largely abandoned the anti-scientific stance. Many of those religions perceive their role not as challenging science but rather as trying to provide reasons and encouragement for moral living. They are prepared to acknowledge the unscientific nature of scripture, particularly Genesis, and are willing to move many religious stories (virgin birth, miracles, resurrection, etc.) into the realm of interpretive psychology or mythology. On the other hand, many conservative religions have built much of their daily preaching and theology on anti-science. Their first point of emphasis is usually the literal nature of the Bible as the Word of God. This literalism conveniently ignores the differing literalism of other sects, the history of the biblical written tradition, the widely differing content of its texts, or the existence of other sacred texts. Higher criticism of the biblical text is treated with the same disdain as science because it uses scientific criteria for its conclusions rather than the revelatory interpretations of the preacher. Conservative religions actively attack evolution and other modern scientific work as well as scientific methodology. Mormonism has moved more and more into this camp, and its leaders have often warned its members about the dangers of science. Many of us know stories of young people having been advised not to pursue careers in science because it will lead them astray and because science is not the real way to acquire valuable knowledge about their lives and the world. 

The changed world after September 11, 2001 has focused our attention on a clear, though little-understood, example of the long-term consequences of an anti-scientific orientation. Hatred of American culture and commercialism—and of the science on which they are based—is a force driving the Islamic terrorist movement. The Islamic world, with some notable exceptions, long ago adopted this anti-scientific orientation and consciously chose to reject modernity in favor of a more conservative, literalist adherence to the principles of the Quran. This decision has long historical roots that are brilliantly described in the book What Went Wrong? written by my Princeton neighbor, Bernard Lewis.[5] Lewis recounts the history of Islam and its dominance over Christianity, starting in the 6th century as it practiced its proselytizing by conquest. Islam's successive conquests encompassed most of the medieval world and led to an arrogance that for a time defined the pinnacles of culture and civilization as those embodied in the principles and ideals of Islamic religion; everything outside was barbaric and unworthy of attention. As the Renaissance (literally re-birth) took hold in Europe, Islam responded to the challenge by adopting some limited Western innovations, chiefly military in nature and application, but maintained a conviction of the superiority of Islamic culture and rejected any commitment to "progress" or change. 

This attitude has persisted to a remarkable degree in a world elsewhere becoming increasingly modern and scientific. The western world experienced explosive growth and power from industrialization and the application of science and technology. Even as the modern Western world (they would say "Christian world") overwhelmed Islam in power and wealth, Islamic leaders continued to respond to the challenge by calling for closer adherence to their religious traditions rather than adopting or adapting to Western innovations. The Islamic Middle East remains the most insular and (excepting military technology) scientifically backward area in the world. The World Bank reports that, excluding revenue from petroleum, the collective trade economies of the entire region are similar to the trade economy of Finland. Access to the Internet is available to less than 0.5% of the populace. The roles of men and women are rigidly defined in ways that, from a Western perspective, abuse and repress women so as to result in the loss of the skilled contributions of 50% the populace. There are important distinctions between modernization and Westernization in the Islamic mind, but the point remains that the dominance of anti-scientific religious ideas in the larger culture has enormous consequences for the growth of individuals, cultures, and nations. 

This example shows the power of a religious system, Islam in this case, to construct a highly refined culture.[6] At the same time, this example shows the danger engendered when that system expresses its religion as anti-science. Theology is a world and a discipline all its own with a rich and valuable tradition of scholarship and commentary on morality and philosophy. Theology is not, however, cumulative in the way that science is, nor is it beholden to other disciplines nor to community consensus nor external evidence as is science. Hence, I believe, religion is finally less attractive as an epistemology, a means of understanding the world around us. 

In this essay I will present the views of two men, one representing a scientific and the other an anti-scientific view. Steven Weinberg expresses the view of science and Bryan Appleyard presents a view deeply skeptical of science from an historical and philosophical perspective. While these points of view are personal to these two individuals, they are generally representative of polar views about science. I have chosen an anti-science spokesman for the religious perspective because the views of most religionists may be anti-scientific, but they generally do not address science itself, or they don't understand science well enough to do it in a focused way. 

Readers might also quibble over the selection of one spokesman over another—certainly there are many candidates available. I have selected these two—and quote extensively from each—because in a precise and eloquent way they move the discussion of religion vs. science well beyond the circle of familiar bromides in which it has for so long been trapped. Moreover they engage each other fairly directly on the same ground. Of course, science, anti-science, and religion have many other spokespersons and points of view advancing their own arguments. These limitations are designed to keep the argument to a reasonable scope. 

The View of Science

Steven Weinberg is one of the leading physicists of the 20th century. He accomplished a major theoretical synthesis in physics in unifying the weak and the strong nuclear forces. He was awarded the Nobel Prize in Physics in 1979 and the National Medal of Science in 1991. He has published a number of books for general readers describing science and its meaning, including a description of the events of the Big Bang called The First Three Minutes.[7] The American Association for the Advancement of Science sponsors a Program of Dialogue between Science and Religion. In 1999 Weinberg was asked to participate in this discussion and later prepared an essay, "A Designer Universe?" that appeared in the New York Times Review of Books[8] It is from that essay that much of this material is drawn. 

For many scientists who express a belief in God, their God is what has been called a "God of the Gaps." In the history of scientific understanding, the idea of God was sometimes used to fill in the gap between areas of scientific understanding. We understand stars and the Universe, but not the creation of the Universe itself, so God fills the gap and is described as the architect who started it all. We understand the variety of organisms and how they evolved, but not how the first one existed, so God is the source of life. We understand the complexity of animals and life, but not the special intelligence of human life, so God is the source of the spark of the human soul. This latter notion is expressed by Michelangelo's artistic portrayal on the ceiling of the Sistine Chapel with God reaching out to touch Adam's hand. 

Weinberg believes that it is time to give up on the "God of the Gaps." While there are many things that scientists do not yet understand, almost all of the big gaps have been filled. We understand how the Universe started. We understand how life began and how it has proliferated with such success and variety. We understand the special position of human life and realize that this difference is one only of degree, not of type or quality. We know that other animal species are self-aware. Other animal species have language, tool-making ability, altruism and sympathy, and so on. Weinberg says, "As far as we have been able to discover the laws of nature, they are impersonal, with no hint of a divine plan or any special status for human beings. In one way or another, [we] struggle with the necessity of facing up to these discoveries."[9]

In "A Designer Universe?" Weinberg begins by asking what such an intelligent designer would be like. 

It used to be obvious that the world was designed by some sort of intelligence. . . .Above all, the wonderful abilities of living things seemed to point to a creator who had a special interest in life. Today we understand most of these things in terms of physical forces acting under impersonal laws. We don't yet know the most fundamental laws, and we can't work out all the consequences of the laws we do know. The human mind remains extraordinarily difficult to understand, but so is the weather. We can't predict whether it will rain one month from today, but we do know the rules that govern the rain, even though we can't always calculate their consequences. I see nothing about the human mind any more than about the weather that stands out as beyond the hope of our understanding it as a consequence of my personal laws acting over billions of years. 

There do not seem to be any exceptions to this natural order, any miracles. I have the impression that these days most theologians are embarrassed by talk of miracles, but the great monotheistic faiths are founded on miracle stories—the burning bush, the empty tomb, an angel dictating the Koran to Mohammed—and some of these faiths teach that miracles continue to the present day. The evidence for all these miracles seems to me to be considerably weaker than the evidence for cold fusion, and I don't believe in cold fusion. Above all, today we understand that even human beings are the result of natural selection acting over millions of years. I'd guess that if we were to see the hand of the designer anywhere, it would be in the fundamental principles, the final laws of nature, the book of rules that govern all natural phenomena. We don't know what the final laws are yet, but as far as we have been able to see, they are utterly impersonal and quite without any special role for life. There is no life force. As Richard Feynman has said, when you look at the universe and understand its laws, "the theory that it is all arranged as a stage for God to watch man's struggle for good and evil seems inadequate."[10]

One of the most controversial sections of Weinberg's essay is his treatment of the problem of pain. It is controversial because, in effect, he pursues religion into an enclave where it has generally felt itself safe from the incursions of science—the arena of values and morals: 

The prevalence of evil and misery has always bothered those who believe in a benevolent and omnipotent God. Sometimes God is excused by pointing to the need for free will. . . .It seems a bit unfair to my relatives to be murdered [in the Holocaust] in order to provide an opportunity for free will for Germans, but even putting that aside, how does free will account for cancer? Is it an opportunity of free will for tumors?. . .The prestige of religion seems today to derive from what people take to be its moral influence, rather than from what they may think has been its success in accounting for what we see in nature. Conversely, I have to admit, that although I really don't believe in a cosmic designer, the reason that I am taking the trouble to argue about this is that I think that on balance the moral influence of religion has been awful.[11]

Weinberg points out that there are endless historical "examples of the harm done by religious enthusiasm, and he cites a few. Then, however, he points to one example sometimes cited as a benefit of the moral influence of religion, the suppression of slavery. He argues, however, that closer scrutiny provides a very different view. While it is true that many abolitionists had religious motivations, Christianity and most world religions lived comfortably with slavery for centuries. The abolition of slavery in England occurred because of the non-religious influences of rationalism. Weinberg summarizes: 

As far as I can tell, the moral tone of religion benefited more from the spirit of the times than the spirit of the times benefited from religion. Where religion did make a difference, it was more in support of slavery than in opposition to it. Arguments from scripture were used in Parliament to defend the slave trade. . . . With or without religion, good people can behave well and bad people can do evil; but for good people to do evil—that takes religion . . . . One of the great achievements of science has been, if not to make it impossible for intelligent people to be religious, then at least to make it possible for them not to be religious. We should not retreat from this accomplishment.[12]

These are strong statements. Weinberg asserts that all of science denies the existence of God. Further, he condemns religions of all sorts for intellectual bankruptcy and for certain actions done in the name of God. He clearly believes that the world would be a better place without the contentions of religious groups and the behavioral structures constructed in the name of religions. It was a revealing exercise for me to try to imagine the course of history as it might have been without the presence of religion or the actions of religious groups. For example, what might European history or the Middle East look like without the Crusades? But of course the roots of the Crusades extend back to the Islamic conquest of Jerusalem, and still further back to the inheritance decisions of patriarch Abraham. 

The View of Anti-Science

Of the many types of anti-science, some are simply designed to further self-interest, such as the reported sightings of aliens and UFOs by tabloid journalists or miracle cures promoted by unscrupulous medical charlatans. Other prominent examples are Biblical Creationists. Employing inaccurate or selective data from scientific sources, Creationism is genuine anti-science in that it denies the foundation and methodology of scientific operation even as it employs the label of scientific thinking. Creationism is also a political movement with a political agenda in churches, educational institutions, legislatures, and in the homes of true believers. 

More thoughtful critics of the enterprise of science as it operates within society, especially in our century, claim that science is a destructive force in our culture. Some, such as Oswald Spengler, argue that science is ultimately a self-destructive force in society and doomed in its own operation. Others, like Vaclav Havel, directly challenge the Jeffersonian model of scientific public policy and submit that science is an enterprise fundamentally disruptive to our social fabric.[13] Havel's perspective is not a familiar one since his, and his country's, view of science were drawn from Soviet science that was malformed and constrained by Communist politics. Soviet science, including such egregious abuses as Lysenkoism,[14] is not representative of real science, but does provide a cautionary illustration of what happens to science when it is directed by an authoritarian system. 

Anti-science has had many champions over the years. Some, like Spengler, have been hugely influential in modern culture. In his enormous work The Decline of the West (1918),[15] Spengler proposes a kind of historical determinism for various cultures. This kind of encyclopedic cause-and-effect analysis of civilizations through the course of history is not for the faint of heart. Spengler, like Gibbon before him and Arnold Toynbee and Theodore Roszak after him, attempts to create a model for the rise and fall of civilizations by finding common elements of growth and decay. His analysis seeks to identify the fatal flaws in our civilization as well as in earlier civilizations. He predicted the demise of our modern age by the year 2000. 

Spengler's work has remained a topic of heated discussion for decades. It has spawned many similar treatments including several New Age and counterculture books and theories. The Spenglerian model grows from an uneasy marriage of German Naturphilosophie with the early philosophy of Friedrich Nietzsche. Using the metaphor of the seasons, Spengler asserts that each historical epoch begins with a springtime flowering in an "Apollonian" spirit, a world view and culture of organic forms, art, and of faith. This changes slowly into a romantic longing for the transcendent (Sehnsucht nach dem Ubererdischen) during the heat of summer. Next, in the autumn of a culture, this view becomes intellectualized—as happens in the tale of Faust—a process by which "culture" evolves into mere "civilization," the winter of the epoch. A major component in this change is the rise of science within the society. Ideas of personal destiny are replaced by ideas of causation. Cause and effect analysis replaces the notion of a natural order in life. Mathematics remakes the tangible world into arid, scientific abstractions. Quality of life degenerates into budgetary priorities and human associations become regulated by governments. The idea of government acting as a servant to people is replaced by government acting in its own interest in the ruthless pursuit of power. The idea of scientific causation is forced onto the "natural" phenomena of the world. 

Spengler wrote this book during WWI and the decade preceding. European culture was everywhere in upheaval, and he used the most recent developments in physics as supporting evidence to demonstrate the failure of science, not realizing that those years were a time of crisis in physics, the collapse of the old Quantum Theory, soon to be resolved by major new developments. He dismisses quantum mechanics and relativity as "card houses of hypotheses" created with a kind of desperation in the face of intellectual failure. He points to the increasing use of statistics and statistical arguments as evidence of science's failure to achieve its aim of exactness. To Spengler, this illustrates the compromise of science's aims, philosophy, and honesty. He also points to the increasing reliance in science on formulas and symbols (abstraction rather than tangible models), which ironically prepares the winter civilization for a new spring because, in his historical analysis, simple numerical regularities and patterns inspire the birth of religious belief and ritual. Numerical mysticism appears in every new faith, and thus to Spengler, the form of 20th century physics not only points to its demise but also to the immanence of a new epoch, which, arising from the arid exhaustion of science and abstraction, will be infused once again with religion and mystery. 

A more recent spokesman for this kind of viewpoint is Bryan Appleyard, an influential British writer on science and philosophy with an important weekly column in The Sunday Times (London). He has published a number of books, but most of the material quoted below is taken from Understanding the Present: Science and the Soul of Modern Man.[16]

Appleyard presents a fairly complete and accurate history of the development of modern science and with polemical style identifies several villains, especially Galileo and Newton, who disrupted the comfortable harmony of man and the world by letting telescopes and mathematics intrude. Newton especially comes in for criticism. It was Newton who replaced the divinely informed world of Aquinas and Aristotle with the cold mathematics of the modern universe—neutral, mechanical and devoid of value. 

In the weak sense Newton may have celebrated the magnificence of God by demonstrating the overwhelming order of his creation. But, in a much stronger sense, he had demonstrated the power of specifically human reason, unaided by God. Man could now see immense distances, he could forecast the future, he could understand what he could not experience. Was not Newton's real achievement to turn men into gods?[17]

Appleyard continues his history of science by describing the separation of humanity from knowledge by adding the work of Darwin and Freud to the story. 

First Copernicus had turned us into a cosmic speck, secondly Darwin had robbed us of any privileged position in creation, and finally. . .Freud had shown that man was not even master of his own mind. But the scientific procedure offered the possibility of a controlling mastery. "Man's observation of the great astronomical regularities," Freud wrote, "not only furnished him with a model for introducing order into his life, but gave him the first point of departure for doing so.[18]

The 20th century is a turning point in Appleyard's history: 

The public image of science changed in our century. It changed because the smiling mask it had been wearing suddenly fell away to reveal a face that was as horrible as it was wonderful. Primarily this happened because science over the last hundred years has become so visible to so many. A technological explosion as well as environmental anxiety, nuclear weapons, mechanized total war and all the moral and political complexities of economic growth have put science at the center of the public realm. It has been brought to trial before a new kind of jury, the jury of popular sentiment, whose verdicts are cruder and whose anxieties are more politically potent than those of the philosophers. Suddenly science's achievements can simply be viewed as crimes, its knowledge as sin.[19]

Here Appleyard is pointing out that some of the traumatic consequences of science, of its straightforward technological application through mechanized war, for instance, or industrialization with all its attendant social displacement, have lead in the public imagination to the condemnation of science as a kind of Dr. Frankenstein. Meanwhile, however, the classic, mutually exclusionary philosophical definitions of science and religion have provided science with an easy rejoinder to such accusations. 

The division between scientific knowledge and the world produces a cast-iron moral defense [for science]. The question of whether to employ the atomic bomb, the scientist will argue, is precisely the same as the question of whether one uses a gun. A discussion of the moral status of the weapon is irrelevant or meaningless; all that really matters is the soul of whoever might pull the trigger. Nothing has changed except the effectiveness of the tools, the scale of the possible error.[20]

This, of course, is a more elaborate formulation of a familiar kind of defense of technology: "Guns don't kill people; people do." Appleyard, however, finds this kind of logic deeply suspect. He describes our current position: 

Relativity, quantum theory, and chaos reveal the style of our new science. As the nineteenth century ended in a mood of sublime confidence that human knowledge was nearing completion and our power, through the application of that knowledge, was approaching that of the gods, so the twentieth century began—and has continued—by destroying the foundations of that confidence. Extraordinarily, that process of destruction has taken place both from outside science and from within.[21]

Finally, Appleyard comes to his conclusion: "Science made us, science broke us; it is time to start making repairs." In other words, science engendered our optimism that human knowledge would master the world and its problems, but then it was science itself that dashed those hopes and has since even incorporated the failure as part of its theoretical basis. Science is and has been a fundamental part of the problem all along. He lists a few of the efforts made to "re pair" this circumstance and rejects each in turn. These attempts include: 

Environmentalism. "Environmentalism has expanded to become an entire moral, social and political orthodoxy. As such it has joined forces with a whole range of other anti-progressive movements which advocate the abandonment of economic growth and the return to 'natural' ways of life. . . .[T]he purpose side of the ecological deal says only that we have an obligation to survive—scarcely a significant spiritual insight."[22]

A Return to Orthodox Religion. "Liberally redefining the faith to embrace or co-exist with science [the Widtsoe, B.H. Roberts, et al, position] is unconvincing because it is too obviously trying to make the best of a bad job. . . .It merely attempts to pretend it is not a problem."[23]

A New Spirituality of Science. "In one form this could—and does in writers like Bronowski, Sagan, Hawking, Feynman and Hofstadter—arise from our straightforward acceptance of the progressive, evolutionary vision that science provides. . . .Its proposition is, in essence, that science is the truth, there is nothing we can do about it, so might as well submit. Philosophers have colluded with this. . . .[But] I believe it is self-evident that, if we are to have philosophy or religion, the first qualification of any claimant to those titles must be that they are different from and independent of science."[24]

A New Spirituality Arising From Within Science. "By this I mean the hope many have derived from modern developments like quantum mechanics and chaos theory. Some—like Fritjof Capra—say these point to a possible future convergence between ancient religious insights and new scientific ones. Others—like David Bohm—attempt to construct entirely new visions based on the anti-mech anistic tendencies of the new science. But. . .science is mobile, its very nature is constant change. One generation's certainty is quite likely to be overthrown by the next. It may be true that quantum mechanics points to a deeper, spiritual realm—but the knowledge of that truth must come from outside and be independent of the quantum, otherwise it remains dependent on the whims of science."[25]

With a good deal of courage, Appleyard advances a solution to the difficulty. Unfortunately, it is a complicated argument based on the idea of "private languages" presented in the philosophy of Ludwig Wittgenstein. But, in fact, it also seems to be the central argument of our time against the rational hegemony enjoyed by science since the Enlightenment. 

A private language would be one that only had meaning to the user. The example is employed of a man who wishes to record the experience of a particular sensation in his diary. It is not a pain or an itch, there is no word that describes it. So he uses the letter "S" to record each occurrence of this sensation. Now this letter "S" might be taken to be a word in a private language that has meaning only to the man. But Wittgenstein concludes that it is not, rather that such a word is quite meaningless. The point is that, in order to get to the word "S," the man had to go through the language we all use. To say that "S" stood for the sensation requires him to employ the word "sensation." He cannot isolate himself and his words from the public realm of language. He must have language before he can have the concept of sensation. There cannot be such a thing as a private language because language is, by definition, a public thing. 

As I have said, this may seem to be a technical point. But place it alongside Descartes and its profound significance begins to emerge. Descartes's cogito, ergo sum was an assertion that the one thing of which he could be certain was his own experience on the basis of his own thinking process. But that ultimately is an assertion of a private language. . . .But Wittgenstein destroys the point: the cogito is like "S," and we cannot arrive at it without going first through the public realm of language. Language comes before cogito; language gives us our selves. 

Locked in this remote and difficult philosophical work [Wittgenstein, Philosophical Investigations, 1953], this is, I believe, the first—and most entrancingly beautiful—sign that we might be in the process of escaping from the loneliness of the classical scientific vision. For, if the scientific self is revealed to be a convention, a delusion Russell would say, then it follows that science too is a convention, a specific choice rather than the privileged road to truth. Science may, at last, be relativized and thereby humbled.[26]

First of all, let's be clear that this is the most serious kind of postmodern argument about epistemology, about getting (or not getting) at truth. It addresses the matter of "discourses," and not of "facts," which in this contemporary view are only available through language conventions anyway. Whatever discourse we use, even the skeptical, questioning, faith-opposed Cartesian language of science, we are locked before we speak into the public convention of words. And if absolutely all "discourses" are a matter of public convention, then all are relative and none, including science, has any more claim on authenticity or on proximity to the "real" than any other. Of course, this would not preclude some thing like mystical or revelatory confirmations that might not be conveyed in language at all, but through "illumination" or vision or feeling, something available to religion but not to science. 

If this kind of thinking about science and philosophy were to win the day, it would constitute a kind of counter-Cartesian (anti-science) revolution, and we would stop talking about getting at or to the "truth" by rational means. I am not persuaded that this is likely to happen. Appleyard misses several fundamental things about science and its operation. It is disingenuous to say that science is a "choice," that the world chose Newton's science over magic as if these were equivalent options. Science works. It has an operational effectiveness and predictive capability that cannot be matched by its competition: magic, religion, philosophy, creation science, space-alien shamanism, or whatever. Science or something like it has always been part of the human condition because as thinking animals, we are inquiring by nature. We have always looked at the stars with wonder and have always needed explanations for our observations. 

Moreover, science is unlike other intellectual disciplines in that it deals with the objective world rather than judgments, philosophies, rhetoric, or opinions. The movements of the heavens are real, and the model we choose to explain those motions is demonstrably scientific in nature. The successive replacemerit of Ptolemaic, Newtonian, and finally Einsteinian cosmology was forced on us because theories were inconsistent with observational data. New models are always available and will eventually be accepted if their accuracy is superior, but the point is that the comparison is done against the observations, not against a subjective philosophy or an argument from authority. Appleyard glosses over this methodology as if there were a conspiracy of scientists. When the nuclear age began, investigation led to the atomic bomb and also to nuclear reactors, nuclear medicine, and glowing watch numerals. It is unreasonable to think that the process of scientific investigation could include or exclude, by choice, any subsequent discoveries. Meanwhile, there is every reason to believe that external, ideological control (the agenda of non- or anti-science) can and does distort, obscure, even eliminate the horizon of possible discovery. 

An Odyssey of Belief

The third view of Science and God mentioned in the title of this essay is my own. Certainly that view is not as profound or as eloquently established as the other two, but it is my own and perhaps has value in the context and autobiography that gave it roots. My credentials as an LDS believer to comment on this subject are good, if rather ordinary. I grew up in the church, served a mission, married in the temple, went to Brigham Young University, and served in bishoprics and on high councils for many years. I am a charter subscriber to Dialogue and Sunstone. Though "front and center" for most of my church life, I was discontent. I studied Chemistry and Physics at BYU and later at Princeton, then entered a program at Princeton for History and Philosophy of Science where I studied with Thomas S. Kuhn. For some readers, that last sentence probably provided the "Ah hah!" moment in which I've given away my guilty secret, namely that I was led astray by secular influences at a godless university. The fact is that my discontent had much earlier origins in Utah. 

As a young man, I probably appeared as too inquisitive and potentially disobedient, especially for a widowed mother with five other children (also bright and challenging) to raise. When I was in my early teens, a kindly uncle gave me what he supposed would be the antidote to my questioning, scientific mind. It was Joseph Fielding Smith's Man: His Origin and Destiny.[27] The effect it had was quite the opposite of the one intended. At the time I didn't understand much of what was in the book, but I instinctively knew that it was wrong. I was turned off by its harsh polemic and its descriptions of science that were so different from what little I knew then. It made me distrustful of religion and authority. Looking back over the decades, that was a pivotal point in my intellectual and spiritual life. In some sense, the rest of my life has been spent in resolving the issues raised by that book. But as I moved away from the book over my intellectual life, the official church seems to have elevated it (or allowed its elevation) to near-canonical status. Evolutionary biology may be taught at Brigham Young University, and there may be statements to the effect that the church takes no official position on evolution, but many of the assertions in Man, His Origin and Destiny, plainly anti-scientific, have been repeated often and publicly by church authorities, and they even appear in the "Chronology" section of the Book of Mormon, 1992 edition. Once again, the church can't really have it both ways. 

I studied the church, doctrine and history, and I studied science, quantum mechanics and relativity. I remained active in the church by yielding to the demands and rewards of service. Yes, I told myself, the lessons and sermons were flawed, but I was able to assist in bringing the work forward. I had certainly not been unaware of the tensions in the church, but I was deeply shocked by the "September Massacre," the orchestrated excommunication of several LDS intellectuals that took place in 1993. Though not a direct attack on me, it seemed aimed squarely at people like me with my intellectual position in the church. It and the events thereafter challenged my senses and orientation like the shocks of an earthquake—the foundation of institutional trust was simply gone, and I found no vantage point within the church on which to stand. I resigned my church callings but continued to attend church though I soon realized that this was a futile attempt to hold on to what was no longer there. I encountered the literal truth of the old jibe: "Organized religion is an oxymoron," for the demands of the organization were, in my view, placed far above the demands of religion. Equally offensive to me was the reaction of the community of the church to these events. It was hard to know which was more incredible, the level of willful ignorance about the people and issues involved or the level of indifference. My fellow church members now appeared to me plainly as members of a cult locked in allegiance to a bureaucratic organization, not as concerned believers each struggling with individual challenges of faith and morality. I was no longer comfortable being in the company of cult members. It was abundantly clear that the organization of the church had failed my particular kind of faith though it took years for me to admit this. I have many good and true friends in the church, but our conversation is much thinner these days since we no longer discuss the busy-work of the organization. I am grateful for those friends and treasure their association, but a lot of shared foundation is gone. 

Over the course of my life, I have looked back at some rocky stretches and made some wrong turns, but one constant support has been the life of the mind. For years I walked in a cul-de-sac by trying to compartmentalize science and religion; every turning brought me back to the original problem. What I heard in religion did not square with what I saw: not in history and not in practice. I have come to believe in science as an epistemology more than ever, especially in its anti-authoritarian operation. It is authority and caprice that are the enemy. Such authority can only be maintained at the expense of truth. If a principle is true, it needs no support from authority. Authority is a terrible foundation for an epistemology. In its own operations, the community of science is non-authoritarian. To be sure, there is a scientific bureaucracy with authority figures and some pretense and coercion, but at the core, science and scientists will always finally yield—be forced to yield—to a new idea if it is more in line with the evidence. 

The example of Einstein is often cited. Einstein was an unconventional and very poor student, the absolute lowest in any hierarchy of scientists. After graduation he couldn't get a real scientific position, but worked in a post office. From that position as a freelance physicist, he produced three small papers in 1905. The ideas presented in those papers instantly vaulted him to the very top of the physics community. There was no infighting with the scientific establishment or disdain for his lowly rank; his ideas carried the day. At base, science is remarkably democratic, self-correcting in the face of error, and free ultimately from authoritarian influence. Religion should be the same, but it is not. 

Little by little, I realized how profound my denial had been. Separated from the community of hustle and bustle and left with the ideas alone, I thought about science and God, and I realized that God was gone. Deep space and deep time change the perspective of life and the world so profoundly that God simply disappears. Deep space and cosmology make the earth miniscule and insignificant, not center stage. Deep time makes our existence as biological entities a small event in a vast process. I don't believe in a creator of the Universe. I don't believe that mankind is different from other species in any fundamental way or that there is a heavenly parent of our souls. I don't believe that God intervenes in human history. I don't believe our history does or could include an event such as the Atonement that is supposed to have cosmic and universal importance. There is no plan in this process or any indication of Godly benevolence. The sacred texts of the world's religions are so different and so fraught with problems that it is incomprehensible to me that intelligent people continue to take them seriously, either for content, historicity, or consistency, much less build an entire world view on them. 

I do not feel like an atheist though what I have said makes it clear that the label is accurate. I am not a person without morals, and I don't consider myself as "godless." This simply means that the reasons for my moral behavior are no longer grounded in belief in God. Rather, they are founded in love of the majesty of creation and compassion for my fellow men. I do believe that the human condition requires a spiritual or religious dimension. Certain principles expressed in religion do form a good and necessary foundation for making moral judgments. But I define those principles very carefully—they are ethical principles, not bureaucratic or authoritarian ones. I am in favor of serving my fellow man, but not in favor of proselytizing. I am in favor of feeding my spiritual soul, but not in the ways of organized religions. I hope that we can come closer to the ideal of universal brotherhood, but I see no hope for it as long as we continue to value labels like Mormon, Catholic, Christian, Jew, Muslim, etc. 

In defining my current moral orientation as a non-believer, I'm not happy with words like "spiritual" or "religious," but they express the feeling more than "internal psychology" or some other made-up phrase. It is clear that human beings are more than scientific automatons, as Appleyard complains. I suppose that I might be labeled an Ethical Humanist. I think that people and societies do have a need to believe in the power of good. I'm fairly certain that that power of good is not the same as religion, and it is certainly not the same as organized religion. Valid spiritual impulses are often harnessed to church creeds as a cynical exploitation of good will. 

I believe there is a need for an inner dimension beyond the social connection to our community. I believe it is useful to pray though it's hard to say exactly what that is for someone like me—perhaps it is simply communicating with one's own psyche or resetting one's bio-rhythms. Of more interest and concern to me is the internal life of the mind that needs nourishment beyond sociology and psychology. In that regard, I find great appeal in the critical work of Immanuel Kant. Kant is firmly fixed in a scientific world and argues that our senses and innate categories of experience let us generate perceptions of the world as we search for truth. Kant's famous Categorical Imperative describes a morality or moral pressure for ethical behavior based on conformity to laws of nature and the idea that all men should behave similarly as a consequence. A just society and a scientific morality would be the result. 

I find great satisfaction in the life of the mind and, despite Appleyard's relativist objection, literally believe the truth of Descartes' phrase cogito ergo sum—I think, therefore I am. I take great delight in music and art and find surprise at the joy and pleasure I derive from these. Why does the brain react with pleasure at things of beauty? Thinking as a scientist analyzing the laws of nature, I believe that I have greater wonder and respect for the world and its creatures than I did when I viewed them as products of a creator. With no expectation of another life, this one and the living of it are more precious. I share the feelings of many Jewish friends who believe that their lives continue in what they leave behind. 

Charles Darwin realized the profound changes that his work would generate in society. He realized how deeply the notions of evolution would challenge ideas of God and creation and their place in our culture. At the same time, there were satisfying intellectual substitutes. The final sentence of On the Origin of Species (1859) expresses Darwin's pleasure at this new view of the world: 

There is grandeur in this view of life, with its several powers, having been originally breathed into a few forms or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being, evolved.[28]

The world makes more sense being driven by natural law than by a distressingly absent God. My mind shares Darwin's sense of grandeur and is satisfied with those conclusions. 

Appleyard is right about this much: science is not a final body of knowledge. It is a process of investigation stripped of the limitations and constraints of context and authority. To be sure, those things do intrude on the process because scientists are people, but they do not last long unless there is some element of correctness in them. The cutting edge of science is objectivity. The final recourse is to the object, whether a chemical element, a star, or a mathematical equation. How wonderfully different that is from judgments in other areas of our lives where the final recourse is based on the arguments of lawyers or the Supreme Court's interpretation of a piece of legislation, or business success is based on the persuasiveness of a marketing campaign rather than the real excellence of a product, or where some arbitrarily labeled moral behavior is based on a tortured reading of selected Bible verses or an ambiguous conference talk. 

Meanwhile, fundamentalist believers in the Bible and the Quran hold up their "faith" or "testimony" in the face of every challenge without examining either the challenge or the faith. In a Los Angeles Times review of Catholic William F. Buckley, Jr.'s, anti-science book, Nearer, My God, Martin Gardner describes the problem. "I put down Nearer, My God with unbounded admiration for Buckley's courage and honesty, and the depth of his piety. There is not a trace of hypocrisy in his book. I also came away with the sad realization that Buckley is guilty of what has been called the sin of willful ignorance. He has never considered it worthwhile to learn much about modern science or recent biblical criticism, much of it by Catholic scholars. He has made little effort to think through the implications of his beliefs in the light of such readily available knowledge."[29] Such ardent believers are unwilling to live in the real (or scientifically accessible) world, and from my perspective the rejection of science has led them into mental captivity. It has given some over to the control of possibly unscrupulous leadership with political or economic agendas. Their intolerance and fervor lead to the kind of immoral behavior they rail against. 

The "sin of willful ignorance" is practiced by many in the Mormon church as a "commandment of obedience." We are counseled by our leaders not to read science or history or anything that is not "faith-promoting." What can that be called except censorship on the part of the authority and willful ignorance on the part of the audience? I will concede that asking questions is a slippery slope. If one asks difficult questions about science and religion and pursues the implications of their answers, the consequences can be profound. I resisted this deeper level of examination for years, but finally faced up to the need to be honest with myself. The answers that I found to questions about science and religion were unequivocal and compelling. It may be good advice to avoid the slippery slope of questioning, but I believe it is an impossible strategy in the long run. Though the risk associated with learning may be high, what is the risk associated with ignorance? What is the purpose of going through life without asking questions or limiting questions to easy ones? 

It seems to me that the dangers of anti-science and anti-intellectualism are very strong, especially in the church. The example of Islam makes clear the dangers of failing to accept and assimilate science and technology into our culture, on an individual and societal level, especially as they confront religion. The struggle between science and religion may be seen as a battle between progress and ignorance (or between light and darkness, to use a familiar metaphor), and I am very nervous that the battle is not merely metaphoric. I believe anti-scientists of whatever persuasion are clearly wrong in urging us to choose a non-scientific way. I'm convinced that it is dangerous not to embrace scientific thinking and scientific methodology. The solutions to our problems lie not in anti-science nor in denial of science, but in doing more and better science and using more scientific attitudes throughout society. We must free ourselves of ignorance and of dependence on non-objective authority. The world and natural law are what they are; we can't select them, but we can learn to understand them. Acting within the world in an ethical, responsible way is predicated on correct understanding of what it is and how it works. Homo sapiens are thinking men—that is our name—and curiosity is our key characteristic. The heavens and the earth have scope and history that is astonishing and awesome to contemplate. The mind is discerning and is able with rigor and honesty to discriminate between truth and falsehood.

---

[1] George Santayana, Interpretations of Poetry and Religion (New York: Columbia University Press, 1990), v-vi.

[2] Stephen J. Gould, Rocks of Ages: Science and Religion in the Fullness of Life (New York: Ballantine Publishing Group, 1999), 4. 

[3] Hugh W. Nibley, The World and the Prophets (Salt Lake City, Deseret Book, 1954), 115.

[4] Sterling M. McMurrin, Religion, Reason, and Truth: Historical Essays in the Philosophy of Religion (Salt Lake City: University of Utah Press, 1982), 18.

[5] Bernard Lewis, What Went Wrong? Western Impact and Middle Eastern Response (New York: Ballantine Publishing Group, 2002). It is interesting that this book was written prior to 9/11/01.

[6] The other great monotheistic religions, Judaism and Christianity, separated the political culture from the religious culture; Islam did not.

[7] Steven Weinberg , The First Three Minutes (New York: Basic Books, 1993).

[8] Reprinted in, Steven Weinberg, Facing Up: Science and Its Cultural Adversaries (Cam bridge, Mass.: Harvard University Press, 2001). Also available in The Best American Essays, 2000 (New York, Houghton Mifflin, 2000) and Best American Science Writing, 2000 (New York, Ecco, 2000). 

[9] Facing Up, 233.

[10] Ibid., 232. 

[11] Ibid., 240.

[12] Ibid., 242.

[13] Vaclav Havel, "The end of the Modern Era," address given at the World Economic Forum, held in Davos, Switzerland, 1992, reported in summary form, New York Times, 1 March 1992.

[14] Lysenkoism is named after a non-scientific peasant plant-breeder Trofim Denisovich Lysenko [1898-1976]. A powerful Communist functionary, Lysenko was the leading proponent of a view of evolution that rejected "natural selection" and genetics. Under his guidance, science was not directed by the most probable theories tested through controlled experiments, but driven instead by state ideology. The result was the steady deterioration of Soviet biology and the misdirection of huge amounts of capital into agricultural failures. Meanwhile, scientists either groveled, confessing their errors publicly and embracing the wisdom of the Party, or they were fired. Some were condemned and sent to labor camps. See http://skepdic.com/lysenko.html. 

[15] Oswald Spengler, The Decline of the West, Abridged Edition, trans. Charles F. Atkinson (New York: Oxford University Press, 1991). Spengler's Der Untergang desAbendland.es, Umrisse einer Morphologie der Weltgeschicte is insipidly translated as The Decline of the West. It would—in a more literal translation—be entitled something like: "The Demise of Western Civilization, Sketches of a Morphology of World History."

[16] Bryan Appleyard, Understanding the Present: Science and the Soul of Modern Man (New York: Doubleday, 1993).

[17] Ibid., 58. 

[18] Ibid., 72. 

[19] Ibid., 130.

[20] Ibid., 131. 

[21] Ibid., 156. 

[22] Ibid., 214. 

[23] Ibid., 215.

[24] Ibid., 216.

[25] Ibid.

[26] Ibid., 226.

[27] Joseph Fielding Smith, Man: His Origin and Destiny (Salt Lake City: Deseret Book, 1954).

[28] Charles Darwin, On the Origin of Species By Means of Natural Selection or the Preservation of Favoured Races in the Struggle for Life (London: John Murray, 1859), 490.

[29] Martin Gardner, From the Wandering Jew to William F. Buckley, Jr.: On Science, Literature, and Religion (Amherst, New York: Prometheus Books, 2000), 345.

[post_title] => Search for an Epistemology: Three Views of Science and Religion [post_excerpt] => Dialogue 36.1 (2003): 89–108
A claim is frequently made that science and religion are not incompatible. The contention is that science and religion can be made to co-exist by compartmentalization, that is, by carefully limiting the scope of each so that neither intrudeson the sphere of influence of the other. Such an approach is folly. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => science-and-religion-a-dialogue-search-for-an-epistemology-three-views-of-science-and-religion [to_ping] => [pinged] => [post_modified] => 2024-01-11 01:14:50 [post_modified_gmt] => 2024-01-11 01:14:50 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10714 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10735 [post_author] => 2301 [post_date] => 2018-03-27 03:12:48 [post_date_gmt] => 2018-03-27 03:12:48 [post_content] =>

Duane Jeffery is a professor of zoology (now integrative biology) at BYU. He has published numerous articles on genetics, evolution, and LDS history and doctrine. He is also a member of the American Association for the Advancement of Science, the Society for the Study of Evolution, and the Genetics Society of America. He has been named Honors Professor of the Year at BYU and has been recognized with the Karl G. Maeser Teaching Award. This interview was conducted by Dialogue Associate Editor Keith Norman on 11 August 2001 at the Sunstone Symposium in Salt Lake City. 

K.N.: It's a privilege to be here today to talk with Duane Jeffery. As we were coming in, he said he felt a little intimidated by the size of the room and the number of people. I think Duane should know he's a hero to an awful lot of people here for what he has done and written. I want to start out by asking you, Duane, how you got started in science as a career, and what kind of issues you faced in reconciling the conflicts that would inevitably come up between your religious upbringing and beliefs and your developing scientific career. 

D.J.: Well, I was raised in a rather unscientific environment, a little farming community. It was only when I got to Utah State University that I began encountering a number of problems. I majored in just about everything for the first couple of years, but on my mission I had some experiences with what we might call doctrinal dissident groups or off-shoot groups from Mormonism, and for the first time in my life I began to see that even inside Mormonism there were different ways of looking at scripture. 

On returning to college, I decided to major in biology, and that instantly threw me together with a number of students who were very strong for science and very anti-religious, as well as many others like me who were rather new to the issues. I was also called on a stake mission at that point, and for some reason it seemed as if many of the so-called problem cases were delegated to me. I ended up working with members of various dissident groups—the Church of the Firstborn of the Fullness of Times was a group of major concern in those years and was making tremendous headway among LDS church members—and we didn't have very much doctrinally at that time with which counter it. So I found myself not only working with several missionary contacts who were in science and interested in evolution and materialist philosophies and so on, but also trying to find out what was going on in my own religion. In all of that mix, I was having a very heady time but expended far more effort studying my religion than studying science, which in many ways has not benefited my career. 

I was impressed with the director of the LDS Institute of Religion at Utah State, Wendell Rich, who was in the process of finishing his book Distinctive Teachings of the Restoration, trying to look at different ways of "knowing," and at how Mormonism interacted with such things. I was also very impressed with Eldon Gardner, who was one of Utah's premier scientists and also a very active and committed member of the church. These two were critical in helping me in those early years, as were a number of other institute and university faculty. 

I encountered a book of fiction called Dorian, written by Nephi Anderson, one of the LDS books written by him back in the twenties and thirties, trying to teach moral principles to LDS youth. This one really dealt with science and religion but quoted extensively from a book called Natural Law in the Spiritual World, and I was impressed with those quotes. This latter book was purportedly by an author named Henry Drummond, but I encountered it in a novel, and I assumed that Henry Drummond and his book were really nothing more than literary devices used by Anderson to get across his message in Dorian. Then I visited a family in Malad, Idaho, at about that time and I found Natural Law in the Spiritual World by Henry Drummond sitting on the bookshelf. It was really a spiritual experience for me because Drummond's argument was that the natural laws we see here in the physical world are just extensions of the laws recognized in the religious universe. That resonated greatly with the Mormonism I had been taught. Evolution clearly presented a problem, and I quickly borrowed the book and devoured it. It clearly was well out of date. Then I began to discover that it had been a very popular book in Mormonism at the turn of the century. It was, for instance, one of the alternate books recommended for use with B. H. Roberts's Seventies Course in Theology, 1907 to 1912. Apostle John Henry Evans, in his biography of Joseph Smith, indicates that Henry Drummond had these marvelous ideas about how God uses the natural laws that we on Earth know, to operate the whole universe, and we see just the lower end of those same laws. He also said that Henry Drummond had made these concepts popular, but he was fifty years behind Joseph Smith in coming to the concepts. 

So those were very heady ideas for me. I was proceeding through a master's degree in wildlife ecology, and it became evident to me that evolution was rather a critical area, which I needed to study further. It seemed to me there were two major ways to evaluate it. One was by means of paleontology and fossils, but I thought that approach was primarily interpretive—you find a fossil, then you "interpret" what it means. (I was very naive!) You need to do much more than that, I thought. It seemed to me that what was critical and testable was the process of evolution, and the process lay in genetics. So I then shifted gears in my career and started doctoral work in genetics, trying to see what could be learned about the mechanisms of evolution. It's been an interesting study ever since. 

K.N.: I wanted to talk a little bit about how you came to BYU and how that experience has been. BYU has a renowned paleontology collection. It seems paradoxical, all those dinosaur bones which used to be under the stadium somewhere, and I guess many still are. I'm told the Zoology Department was recently rated as the top graduate program on the same BYU campus where the religion department tends pretty much toward literalism in interpreting the scriptures. Is there still a religion department? Did I hear they were doing away with that? 

D.J.: College of Religion. 

K.N.: Okay, well, the religion faculty has traditionally been opposed to the scientific concept of organic evolution, so you have this conflict on campus. You go to one class and hear one thing, and go to another class and hear the opposite thing. To me this is a very intriguing campus paradox. How free do you feel the discussion is on these topics, and how do you deal with students who are troubled by the conflicts they see? 

D.J.: Well, that covers a lot of territory. I came to BYU because BYU's Zoology Department critically needed a geneticist. I had been there a relatively short time when Dallin Oaks became president of BYU. One of his first undertakings was to organize a seminar between selected faculty members in science on campus and what was supposed to have been all the College of Religion faculty. This was an ongoing seminar series. I should explain that a number of those people did not participate. You indicated there may have been some animosity. One of the members of the religion faculty wrote a seven-page letter to his dean to tell him he would never participate in such a Satanic enterprise as meeting with the scientists on campus, and he never did show up. But we had a wonderful series of seminars that established some good among those who did participate. 

K.N.: This would have been when? 

D.J.: This was the early 1970s, and it went on for—oh, I don't know—a year and a half, two years. I don't remember. Somewhere I've got the notes from that seminar, but it was a wonderful discussion between the groups. It did a lot to bring about common understanding. There were still those who felt that science was Satanic. Most of those with that persuasion never attended. Even though one was on the steering committee, he would never come to the formal meetings. However that may be, we established a good rapport. Now a number of those individuals—nearly all, in fact—have since retired and have been replaced, in general, by others who seem not so threatened by science. There are a number there in the College of Religion who seem quite open to many ideas of science and who express the feeling that God can reveal things through sources other than strictly ecclesiastical ones. That has helped. 

Now, you asked about paleontology at BYU. Years ago we did have a gentleman by the name of James Jensen, who loved to collect dinosaur fossils and who pioneered many of the techniques to display those fossils with internal structures. The old way was to put up a big structure with a rebar framework or "cage" and hang everything from that, so you could barely see the dinosaur fossil. Jim was a pioneer in developing internal supports. For those of you who haven't been down to the new North American Museum of Ancient Life at Thanksgiving Point, I would strongly recommend you go. It is marvelous. It's being billed as the largest dinosaur museum on the planet. There you will see the internal suspensions that Jim Jensen pioneered. You see the animals standing there, bigger than this room, a couple of them, and it really is worth the price of admission. They have scores of such reconstructed fossils. 

Well, however that may be, Jim was doing a lot of collecting, and the only place we had to store things was under the stadium, as you indicated. We do have the small dinosaur museum on campus, and people are continuing to work with that. There have been people at BYU who have recognized the strength and power of having this museum, but also others who have been uncomfortable with it. 

There was a movement several years ago to try to get rid of the museum and its collections, which very nearly succeeded, but let me share, if I may, a little anecdote that goes along with that. Wade Miller, a researcher who specializes in mammal evolution from relatively recent periods—Pleistocene and so on—was the director of the museum at that time. He was invited to go to Italy by CES, the Church Education System, and give a seminar to the LDS youth in Italy on science and religion. After he came back from that seminar, Wade came into my office still searching for words, telling me he was still overwhelmed emotionally with not only the deference and respect, but also with the sense of near worship, of awe, with which he had been treated by the young LDS people in Italy. Now it wasn't just Italians; word had gotten out, so there were young people there from Italy, France, Austria, Switzerland, Spain, and Portugal. Young LDS people from six or seven nations were there to hear a Mormon scientist. Wade said it seemed beyond their comprehension that you could be an active Latter-day Saint and be a scientist. He said they would stand around him almost reverentially. He was somewhat embarrassed by the whole way they were treating him. 

K.N.: Were these primarily Mormon students? 

D.J.: Oh, these were Mormon students, but beyond that Wade was invited to be on national television. Since then he's been back on Italian television again, and reporters have made a big point of asking how a religious institution can be studying dinosaurs and fossils. Wade has had the wonderful opportunity of speaking on this issue on national Italian television—how do you buy that kind of coverage? 

But we consistently downplay the whole connection between science, religion, and the gospel. I had an opportunity a few years ago to speak with one of the European CES directors, and I asked him about the situation our young people face in reconciling science, religion, and the church. He said, "Let's be very clear. Our young people face two choices—they grow up, they go on their missions, they come home, then they make a choice. Do they go to university, or do they stay with the church? Those are seen as mutually exclusive categories." The European, and particularly the Italian, universities, he said, are aggressively atheistic, and anyone who goes to university doesn't usually stay with the church. So he said, "Yes, we lose many of our young people." 

We're also losing many in this country. I find myself wondering why this dichotomy—of being forced to choose between science and religion—exists. Certainly, we can find a lot of problems. There really are problems, and I think we ought to be addressing them, but when we're getting such positive publicity—for instance in Italy on national television—it seems to me we're missing a good bet by not doing a little more with that paleontology collection and our other science programs at BYU. 

You mentioned that maybe BYU's Zoology program has recently been rated among the top graduate school programs. That is true; we came out fairly well. Chemistry is also a very powerful department. I think the evolutionary biology team at BYU probably does lead in terms of international recognition and the number of non-LDS students coming to BYU to get degrees. Numerous post-doctoral students from other institutions and countries have been coming to BYU for evolutionary bi ology programs also—we have them from throughout Latin America, South Africa, Europe. There are frequently visiting professors on sabbatical who are coming as well as post-docs, as well as people coming for Ph.D. degrees. It has become a strong program. One of our administrators recently said, "It might seem a little strange that the evolutionary biology program at BYU would be one of our best, but we need to let that be known. We have people of faith who are working with that; we need to let that be better known." So I hope that may happen, but I don't know how extensively it will. 

You raised the question of how free the discussion is at BYU. I wouldn't want to say that we have open discussion of these topics on campus. It still is a science-versus-religion thing for too many people. This problem got pushed to a head in 1992. 

President Rex Lee indicated that he was getting weary of explaining to people what the church's official documents really say about evolution, so he requested that a packet of authoritative materials be placed in the library. At an upcoming "open forum" where anyone could ask him questions about campus matters, he planned to have a student ask him about church and evolution. He planned to then notify the campus community about the collection of materials in the library and, thus, spare himself considerable future time and energy. Such a packet was, in fact, prepared, containing only statements from either the presidents of the church or the entire First Presidency, but after President Lee's announcement, certain campus parties registered concern that the anti-science sentiments of certain apostles had not been included in the library materials. So a small committee was formed to consider the matter, and eventually a packet of materials was presented, with an appropriate explanatory cover letter, to our Board of Trustees in the summer of 1992. The Board at that time consisted of the entire First Presidency, seven of the Twelve, and a few other persons. They approved the packet as representing the official position of the church.[1]

The packet includes five items: 1) the cover letter indicating that the church has addressed the origin of man but not the origin of species and that only the First Presidency can make pronouncements of official doctrine or positions; 2) the oft-quoted November 1909 First Presidency "Origin of Man" statement with its anti-evolutionary sentiments; 3) a brief excerpt from that same First Presidency's 1910 Christmas message, indicating that our religion is not hostile to real science and that "that which is demonstrated, we accept with joy"; 4) the First Presidency's "Mormon View of Evolution/' issued during the famous Scopes trial of 1925, which consists entirely of excerpted paragraphs from the 1909 statement but with all the anti-evolutionary sentiment deleted; 5) the "Evolution" entry from the Encyclopedia of Mormonism, into which the First Presidency had considerable input and for which they furnished excerpts from their official minutes of 1931. 

Personally, I add to these five documents another two of comparable status: 1) the April 1910 responses to questions addressed to the First Presidency after the 1909 statement, and 2) President Joseph F. Smith's editorial of April 1911, indicating that, although he has personal concerns with evolution, the church itself has no philosophy on the matter. The first of the two documents does address the origin of man, giving three options, not one of which includes the literal reading of scripture. The three possibilities, for those not familiar with that literature, are: a) evolution of man by natural processes under God's direction, b) transplantation from another sphere, and c) having been "born here in mortality as other mortals have been." This 1910 document is the last and most explicit, direct statement on the subject traceable to a First Presidency—and in this case, the same Presidency that issued the 1909 statement in the first place. 

All faculty members at BYU were asked, through their deans, to make the packet available to students whenever the question of evolution arises. This has not always been done, but it has greatly reduced, in general, the previous selective quoting of different brethren. But, finally, we do not have open discussion of the topic on campus. It is a matter confined to individual classrooms. 

K.N.: It sounds as if the situation at BYU is a little less polarized, at least, than I had thought, but my perception is that the drift in the church has been toward a creationist interpretation of the scriptures, which seems a little strange to me, given Mormonism's materialist theology—God has a physical body and creation really means organizing preexisting matter. In that sense, shouldn't Mormonism be particularly unthreatened by organic evolution? 

I'm really concerned that we are losing the best and brightest of the generation coming up. You talked about the students in Italy and Europe who were thirsting for discussion of these issues and how rare it is for them to get that. My oldest son started his college career at Case Western Reserve University, which is probably the premier scientific technical school in Ohio, and he was at the time kind of chafing in his church involvement. I unwisely told him I would give him financial support if he went to Institute. (I should have known exercising control or dominion or compulsion over the souls of the children of men is not the way to go.) Anyway, the institute teacher was talking about the scriptural account of creation in very narrow terms, and the question was raised in the class, "What about the dinosaurs?" and he said, 'Ah, that's a good question. I've thought a lot about that, and I think I've come up with something that resolves that quite neatly." Of course the class leaned forward; they were all eager to hear it. Remember these were sophisticated science students, and he said, "You see, the dinosaurs couldn't fit on the ark." 

D.J.: Well, there you have it! 

K.N.: Well, that's what the teacher thought. You know, the class sat in stunned silence. My son said they were incredulous, but apparently the teacher interpreted that as having solved the issue, so he went on with his lesson plan. Sometimes when you ask for bread, you know, you get a stone. When my son recounted this to me, he said, "Dad, I don't think this institute experience is having quite the effect on me that you planned." So how do we salvage this upcoming generation of students, as both scholars and faithful members of the church, when their encounters with the official church border on stubborn irrationalism and even downright silliness? 

D.J.: You ask a difficult question. Of course, that's why you bring it up. I think probably a classic example of that would be the current lesson manual featuring Joseph R Smith. Many here will have undoubtedly run into lesson number 37, which has to do with our being the sons and daughters of God. It builds its entire presentation around the November 1909 First Presidency statement on the origin of man, but it totally ignores everything else that happened in the Joseph F. Smith administration. I talked with a friend of mine who's a member of that writing committee and said, "You know, you put us in a real bind. We in the sciences first of all have to try to reconcile the gospel with demonstrable realities in the sciences, but now you've put us in a position where we have to reconcile Joseph F. Smith with the present church. It makes this even more difficult to do—and to try to defend you as a writing committee— when it is obvious to our students that you have not been honest with the Joseph F. Smith materials." 

He said, "Oh my, I'm afraid we just didn't bring ourselves up to speed on Joseph F. Smith and science," and I had to say, "Well yes, that's a nice statement, but what will we do about it in the future?" I had heard rumors that the next manual would be excerpts from John Taylor, and I had great concerns that they might use a passage from John Taylor wherein he says that new species cannot be generated. I pointed out to my friend that we've been making species since about 1926 or 1927. In that same statement— and this never gets quoted by the anti-science writers—President Taylor said that chemical elements cannot change from one to another. So I said, "You don't go to Hiroshima and tell people the atom can't be split and made into new kinds of atoms, because it jolly well can. President Taylor was trying to say that there are eternal laws that do not change, and unfortunately he picked a couple of bad examples, but if you're going to do the manual on John Taylor, please don't put in those passages, because you're just going to further complicate the credibility of both the writing committee and a prophet of the church, and I don't think we need to get into that." 

He said, "Well, the manual is not going to be on John Taylor." He wouldn't tell me what it was going to be. The church tries to keep that very, very quiet so people don't write all sorts of "supplementary materials" about how to explain what so-and-so said. I can understand that. I'm sympathetic with that, and I don't know what the manual will be, and I just hope it doesn't provoke these kinds of questions.[2]

But it does put us in a real bind. One thing I have learned over the years is how extremely fragile religious faith can be for many people and how absolutely firecracker volatile it can be for others. Sometimes it's the tiniest little thing that will trigger reactions. I had a student come to me one day. He said, "I went to a fireside you gave three months ago on evolution and Mormonism, and I've finally gotten back to the point where I can pray again." I said, "Well, what was the problem?" He said, "You read that letter from President David O. McKay that said the church had no official position on evolution. I could not imagine a real prophet of God ever saying that, and I haven't been able to pray since because of that statement." How unbelievably fragile. I wonder what has gone on in this young man's background to make it quite that way, but he's not alone, and I've certainly seen others like him since. 

So how do we work with students at BYU? We try to work with them in classes, sensitively, openly, honestly, and I try to make clear to them first that the one thing I will not do is lie to them if I can possibly help it. "If there's a topic of controversy here," I say, "I want to make sure that you know everything substantive that's been said on the issue, and I personally don't have any problem at all with divergent statements because it means there's not really a definitive position out there. It's the ones who say there is a position who have to start selecting and choosing their sources." Then, in addition, we spend a lot of time in the office just talking to people individually, trying to help them through some of these questions. 

There has, indeed, been a drift in the church toward creationism. And creationism itself as it is generally used in American society is completely incompatible with basic Mormon theology. We won't take the time here to explore that, but it is just incompatible. People seem to think, "I believe in creation, so therefore I am a creationist." I have to ask, "If you live in a democracy, does that make you a Democrat? We live in a republic; does that make us all Republicans? You're clearly an adult, does that make you an adulterer?" Believe me, you can believe in creation without being a creationist. Creationism is a very, very precise theological position that is absolutely incompatible with Mormonism. 

You mentioned dinosaurs on the ark. . . 

K.N.—Not on the ark. 

D.J.: Creationists have had a lot of problems with what to do about the ark and have pointed out that the Bible says that nothing survived other than what was on the ark, but they have tried to make what was in the water an exception to that, not recognizing that if you have all the sedimentary material that makes up the present strata suspended in the water, which is what they argue, you really have a muddy soup in which virtually no fish and no sea life could live. 

So there are various games the creationists play, but the one I like best is the recent publication, Noah's Ark: a Feasibility Study, by a John Woodmorappe. He's done some things that I think may be of interest here. The publication is advertised as the answer to all the objections about Noah's ark without invoking anything supernatural at all. Well, that's wonderful—that's even in the preface—but as you read the book, you realize that every other page he's invoking supernatural this, that, and the other. 

Still, it's interesting what he's done with dinosaurs. He and other people have suggested that dinosaurs did indeed survive the flood, that they were taken on the ark, that they were taken on as little babies (or possibly dwarf species), and that's why you had to have the clean and the unclean animals. You had to have a few of the clean to feed the dinosaurs and so on. One often finds the argument that the legends of dragons mean that dinosaurs did survive from the ark, and that's where the whole idea of dragons comes from. Post-Noachian people saw dinosaurs, some of which may even have breathed fire—that's perfectly acceptable to those folks—which gave rise to the legends of dragons. 

I do like one little thing Woodmorappe does. He's had to totally give up on the historical creationist position that there could be no beneficial mutations and no new species. He thinks that he can put about 8,000 different kinds of organisms on the ark. Then, after they get off the ark, he has God miraculously speed up the mutation and speciation rates to generate new species so that in only a short time following the date the Bible gives us as the date of the flood (2344 B.C.—it's pretty easy to calculate), we generated all the several million species that are on the planet today from those 8,000 founders. Then God slowed the rates all down again to look like what we have today—this is the book that is not proposing any supernatural events. The dinosaurs got lost in the scramble. I guess the knights killed them all off or something. Woodmorappe never quite deals with that, but that's his book, the latest position from young-Earth creationism. 

K.N.: I'm interested in how you stayed out of trouble or stayed at BYU at all. I work with the Dialogue editorial board, and we've been talking about putting out an issue with the ten or twelve most important articles of all time published in Dialogue. Almost invariably near the top of everybody's list is "Seers, Savants and Evolution," which you wrote, when, about 1975? 

D.J.: 1974. 

K.N.: It's one of the most important things Dialogue's ever published. I've heard—I think Devery Anderson writes about this in his history of Dialogue—that when Ezra Taft Benson heard about the article (I don't know if he was president of the Quorum of the Twelve at the time, but whatever his position), he was flabbergasted that a wacko such as the author could be on the BYU faculty and publish something like this. What kind of flak did you experience, and how have you dealt with that? 

D.J.: Well, that's a long history too. President Benson did get disturbed with my presence at BYU. He did get disturbed over my paper "Seers, Savants and Evolution," and apparently, without naming either me or the paper explicitly, denounced both at a BYU fireside. It turned out that he'd never read it, but he had been told about it by some ambitious underlings in the church who will remain unnamed. 

Gary Bergera and Ron Priddis, in their book Brigham Young University: House of Faith, have a chapter on the issue of evolution at BYU, and they go into a good deal of what went on there. There were attempts to see that I no longer received a check from BYU, but President Oaks headed that off with the help of President Hinckley. And there have been other episodes since. They're probably best left unelaborated. 

I have had the support of a good many friends and other faculty members at BYU and of certain administrators who felt that the kinds of things we have been doing have been positive, have been absolutely necessary. Some of them have themselves had young members of their family who had much the same experience that your son has had, and so they have recognized that people must be given the ability to address these issues. I should perhaps relate that when I was recruited to BYU, I indicated in my interview with BYU's vice president that the university did not have a very good reputation in biology among the nation's universities. Even one of my good friends up at Utah State, a biology professor and stake mission president (who subsequently became a mission president), said, "When we get graduate students from BYU, the first thing we do is throw them into the evolution class, so they can learn what biology is all about." He said, "All they've had is just a mish-mash. They have ideas about biology that are no more organized than confetti at a New Year's party, and we've got to help them get some sort of organization into what they've got in their heads." 

So I mentioned this to the vice president at BYU, and I said, "Why don't you have an undergraduate class in evolution?" and he said, "Well, because nobody's ever proposed it." Well, I happened to know that was not an accurate reflection of the situation, but we left it at that. He was recruiting. So I said, "If I were to come here, we'd probably be suggesting one. How would it be considered?" He said, "The same as any other course." 

So Dr. Clayton White and I proposed such a course. All new courses at BYU have to be approved by the Board of Trustees—and I will shorten this story—in the end, word came back to us from Harold B. Lee (he was at that time the powerful person in the church hierarchy). He said, "Clearly this course is needed in the curriculum at BYU. Tell those brethren to teach the most demanding and rigorous course of which they are capable. Just don't get on any bandwagon and beat the church with it." 

Now by that time we already knew the material that about three years later would go into the paper, "Seers and Savants," so we replied that we didn't see any need to be beating the church with it and did not intend to. We have taught that course steadily ever since 1971—and I see one member here in the audience who was a member of that first class— and over the years, so far as I am aware, we have had two complaints from students to the administration. Both of those have been from students who were rather interested in cultivating a relationship with people upstairs and thought this was a good way to do so. One of them wrote to our president and said, "My grandfather and I have done a pamphlet that clearly sets this whole story straight, and we'd be happy to meet with you, after you have chastised these faculty members here, and show you how God really did things." Our president was not particularly interested in being so instructed, so that sort of died there, but I know of only two such cases. 

Our introductory biology course, where students have less background, often generates more negative response. One of the instructors of the course is a former mission president, and he makes certain that his students get a solid exposure to evolution. One of our vice presidents told me he can always tell when that instructor gets to the evolution part of the course, just from the letters he receives from parents. But so far as I know, we've only had those two complaints about the evolution class itself. 

Just this last Tuesday morning, our college announced that we were going to completely reorganize the six departments in our college of biological and agricultural sciences. Along with that, the committee has developed a college core of courses. I was gratified to see that these core courses included the evolution class. So the course will now be required of virtually all the college majors. 

K.N.: Our time is fleeing rapidly. Before we quit—and I certainly want to leave time for questions from the audience—I want to talk a little about this book, Evolution and Mormonism,[3] by Trent Stephens and Jeff Mel drum, who, I guess, are two of your former students and are now at Idaho State University. 

D.J.: They're both here this morning. 

K.N.: Yes, great. I really enjoyed this book. Duane wrote the preface to it, and I guess you might even say he's its grandfather. 

D.J.: The "fossil." 

K.N.: Well, the book really piles on the physical evidence supporting organic evolution, including the deluge of data in biogenetics and the array of new fossil discoveries, which put to rest the idea of a missing link, as far as I can tell. Talking about a missing link was a big deal when I was growing up, but I guess the links are no longer missing. What kind of response has this book gotten, positive or negative, to your knowledge? 

D.J.: Well, I am aware of many positive responses. I'm aware of a couple negative ones. I see one young entrepreneur has read the book in the last ten days and is already trying to sell a pamphlet here at the Sunstone Symposium to refute it. So it's clearly been seen as significant enough to require a response, though not from any official sources. Trent and Jeff were very, very careful to work through their stake president and have this project carried all the way to the First Presidency, so I don't expect anything negative from official sources at all. 

I hope it will be seen positively because it is a positive book. I spoke with one person who's very familiar with many publications from Signature Books, and he said, "In all honesty, that's probably the most faith promoting book Signature publishes." I find that rather interesting, considering the fact that they've published Wilford Woodruff's journals, and the biography of Rudger Clawson, and other similar works. So I certainly know of many, many positive, good reports about the book and only a couple of negative. 

K.N.: Let's take some questions from the audience. 

Audience Member: What will be the challenges for Mormonism in the coming century? All we've done here today is stir up fossils; what about the science of the coming century? 

D.J.: Well, there will be more from the fossils, I'm pretty sure of that. The fossil record is getting more and more complete every day. Many people think, as I did, that fossils are something you find out there, which you just have to speculate about and interpret, and it's not that way at all. There's a tremendous amount of data that can be derived paleontologically about past climates and so on, which will challenge many of the concepts that our people have traditionally taught or believed. 

But I also see such things as the human cloning controversy, stem cells, debates over resource management and human populations, and continuing brain research as generating significant challenges. I see major fundamental challenges in our still infantile, but already incredible, ability to localize specific behavioral traits to precise areas in the brain and to relate them to specific genes. This rather flies in the face of the concepts of spirit/physical body relationships the Mormons have taught historically, that your body is just kind of a shell. It's like your house; you can live in it, but your personality is totally that of the spirit. Your body is molded to look as it does by your spirit, your personality is that of the spirit, and so on. Clearly we're running into great difficulty as more data accrue, for instance, on mental illnesses and ways to treat these illnesses. Our best ways to treat many of them have certainly been either with surgery or with drug therapy. Those both involve fundamentally materialistic ways of looking at mental illness, and I think that will present considerable challenges to the way that Mormons historically have looked at what a human being is and what humanness really means. 

Audience member: How do you live with the lack of morality in science, especially in such cases as the manipulation of DNA? 

D.J.: Scientists will argue that science is amoral; there will be those persons who argue that it's immoral. Those are two different things. Historically, scientists have said that they're in the business of generating knowledge rather than of determining how that knowledge should be put to use. They, therefore, try to wash their hands of any immoral uses of their knowledge. That kind of naivete was forever shattered August 6, 1945, when the bomb exploded over Hiroshima. 

Many scientists have struggled with that ever since, and we're caught. Knowledge always has two sides to it—it can be used, it can be abused. With the manipulation of DNA, we're going to be able to do some wonderful, wonderful things to better the quality of human life, but we are unquestionably opening up the potential for deep abuse. Now scientists in general, very frankly, do not have the background, the training, the expertise, or the interest to really engage very meaningfully in deciding what regulations we ought to put on those kinds of things. They will argue, as they're doing with stem cells, that you are consigning many people to death if you do not permit stem cell research. The response to that is, yes, but you're killing embryos in the process. 

President Bush, two days ago, tried to take the middle course to permit research only on sixty-some cell lines where the question of life and death has already been decided. That's not likely to be a very workable conclusion. It's a purely political one, even though President Bush insists it's not. Whom are we kidding? 

So, where should the moral fiber for society come from? It won't come from the scientists, because science can't generate morals. It can tell you the implications of certain kinds of practices relating to morals, but it can't really generate guiding moral principles. This is why it is of great concern to me that religious organizations get more actively involved in this entire discussion and debate, but they cannot do it by remaining aloof from the arena of discussion and merely pontificating. That goes nowhere. The Pope has learned this over the years, and so now he puts out formal encyclicals. His recent one on faith and reason is a masterpiece, but the Pope does have a background in philosophy, so he understands a lot of the problems, and he doesn't argue, as we're prone to do in the LDS church, that material and information gained through faith are superior to anything gained through reason. He takes a really much more balanced approach, and even goes so far as to say that it is reason which keeps faith from becoming superstition. 

Now, it seems to me, that religions can do three things with science. They can ignore it, which is what many of our own people do. They can combat it, which is what young-Earth creationists do. Or they can engage it and strive for a meaningful synthesis of interests from a variety of perspectives. But you can engage in that synthesis only if you have built a background that enables you to do so. In all honesty, and it is to be regretted, we in Mormonism have not built a foundation from which we can meaningfully contribute. 

A classic case occurred in the recent controversy over cloning. The National Bioethics Advisory Committee sought to collect sentiments from America's religions. These included Native American religions; they included Islam, Buddhism, Judaism, and many varieties of Christianity, but we as a church opted to say nothing that could be included. Even though the head of the polling committee was an LDS person, the publication appeared with input from a wide variety of religions, but nothing from Mormonism. We became, in that sense, irrelevant to the national discussion on the ethics of cloning, and I think that means we have some work to do. I'm sorry I've given a very long answer that wasn't really an answer. 

Audience member: My follow-up question is, how do we get away from this ivory tower suppression? In 1936 at Ricks, we were studying organic evolution in our zoology and geology classes. We were far enough away from the micro-management of Salt Lake City that that was possible. I'm wondering if our Mormon websites and list-serves such as MormonL wouldn't be the way that we can disseminate information and perspective to these young people you mentioned who are desperate to try to find some accommodation between their religion and science. 

D.J.: Excellent question. There are many websites available. I am not an expert on the internet, so I can't tell you about very many. Eyring has certainly been the granddaddy I think, of discussions on science and Mormonism on the internet. There are a good many others. As with all other things on the internet, you find a lot of assertions that are not founded substantially on the relevant data, so one has to sort through that as well. 

We have tried two or three times to put together organizations of LDS scientists to help with some of these issues, but interest flagged fairly quickly because there's this feeling of always having to swim upstream when dealing with these issues in the church. I wish I had a good answer. I just don't. I think that books such as Jeff and Trent's Evolution and Mormonism are going to be a critical start, but I don't know if they'll be enough to turn the current at all. In the last fifty years, Mormonism has taken on a very evident public stance of anti-intellectualism, anti-science; there has been a real shift since 1954. That has, I think, worked to our detriment. 

Audience member: You mentioned the bias of the curriculum writers for the Sunday School, Relief Society, and Priesthood manuals on Joseph R Smith. It seems to me this conveys a pervasive bias in the seminaries and to some extent the institute programs of the church, which are influencing so much of our young people's thought. I know the seminary student manuals and the teacher curriculum clearly have a bias against organic evolution, even though we have a number of neutrality statements about the church's taking no position. It seems to me that, as a science department at BYU, you would help yourselves if you'd write a letter that asked for, at least, neutrality. 

D.J.: There are some institutional problems with BYU faculty putting out a letter to the brethren. A letter has to follow institutional expectations and go through all the channels between us and the brethren, and sometimes those channels have worked well, and sometimes not. Our administrators are burdened with a great many other issues as well—dress codes and raising money, for example—and sometimes for various reasons their agendas do not seem to find time for these sorts of issues. I've personally been a bit hardened by experience. I also teach a course on the history of philosophy and biology, and we do a good deal with LDS history and doctrine in that as well. I've had two students now who have been training to be seminary teachers, both of whom have told me that in their classes it has been drilled into them that they are not to use the scriptures as a battering ram to try to recruit students to their own particular views of the gospel. Rather they should introduce the scriptures as a place where individuals can go to try to find answers to their personal questions. I don't know that that has become pervasive yet in the system. We still continually hear about LDS seminary and institute teachers giving answers to their students much like the one Keith's son got. The Old Testament manual, for instance, has quoted Seventh-Day Adventist scientists—it quotes young-Earth creationist ideas as though these were good solid science and compatible with Mormon doctrine. I'm just not sure how effectively to address this. There are people who are trying. 

Audience member: This is another follow up on the last question. I'm a retired high school biology teacher, and when I started in the 50s, I got a little bit of flak from the seminary teachers on evolution, but not much, and I thought that by the time I retired, we would have won the battle or war or whatever. Just the opposite happened. As this last gentleman said, it was in the 70s and 80s—I retired in '88—when the seminary teachers began attacking us for teaching evolution in biology, and that was a big disappointment. It's been one of the biggest disappointments of my career that we haven't won the battle in the minds of members of the church, not even in those of the bright students. It's gone the other way. 

D.J.: That has been a common problem. I do know of schools where there's a regular animosity between seminary and science teachers. Others seem to work very, very well together. I know of some places where the science teachers have just gone over and sat down with the seminary people and have said, "Let's work together on this." Sometimes that has worked well, and sometimes it hasn't. I would like to say one thing about seminaries, however. Those brethren and sisters are very, very dedicated people, and I think we can thank them for the fact that we have not had, in Utah, the waves of attempts to put creationism into the public schools that other states have had. You know, those states and legislatures have been torn apart. Hawaii just got their fight resolved a week ago. These conflicts have taken place in Iowa and Kansas and Pennsylvania and Michigan and Wisconsin, and states all over the country. We've had none of it in Utah—no significant suggestion that we put creationism into the science classrooms. It doesn't belong there; it's not science. It could perhaps be brought up in social science classrooms— that would be all right—but certainly not in the science classrooms. Now I think the reason we've not had the pressure here is because our LDS people feel that the seminary system can take care of our children's spiritual concerns; we don't have to be messing around with the curricula of the public schools. Now that can be seen as both good and bad, but I think it has reduced the level of division that otherwise could have developed in Utah communities, and I think seminaries need to be credited and given appreciation for that, though maybe that's a back-handed compliment. They've done some good things, some bad things, but all institutions, including science, do good things and bad things. 

K.N.: A profoundly safe closing statement. Thank you very much, Dr. Jeffery.

---

[1] This decision was reiterated to the university in March of 2002.

[2] The next manual featured President Harold B. Lee.

[3] Trent D. Stephens and D. Jeffrey Meldrum, Evolution and Mormonism: A Quest for Understanding (Salt Lake City: Signature Books, 2001).

[post_title] => Thoughts on Mormonism, Evolution, and Brigham Young University [post_excerpt] => Dialogue 34.4 (Winter 2002): 1–18
Well, I was raised in a rather unscientific environment , a little farming community. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => thoughts-on-mormonism-evolution-and-brigham-young-university-2 [to_ping] => [pinged] => [post_modified] => 2024-01-28 16:50:50 [post_modified_gmt] => 2024-01-28 16:50:50 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10735 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10736 [post_author] => 2302 [post_date] => 2018-03-27 20:56:24 [post_date_gmt] => 2018-03-27 20:56:24 [post_content] =>

Several years ago while teaching the priests' quorum, part of my lesson focused on the deceptive methods used by Satan. I asked my class for suggestions as to what tools, techniques, and deceptive teachings Satan employs. Some of their responses included the immorality in movies, television, and music, or the notion that there is no God. Then the bishop, as president of the priests' quorum and a regular attendee of the class, said, "Evolution." In the years since this event, I've found that there are a number of members who believe that evolution is a doctrine of the devil. It is apparent that many members are not familiar with the official position of the church on the topic of evolution, nor of the past history associated with this issue. The purpose of this paper is not to take a position on whether evolution is correct or is in error, but rather to demonstrate that the church's official stand on the subject is neutral and that many faithful Latter-day Saints, including LDS scientists, accept evolution as a currently valid scientific theory. 

The controversy among members of the church regarding evolution has been around since shortly after Darwin published his On the Origin of Species by Means of Natural Selection. Some of this controversy took place among the faculty at BYU as well as between members of the church leadership. Whereas some prominent Latter-day Saints viewed the teachings of evolution as the theories of men or the wiles of Satan, others have viewed evolution as the method by which God created tabernacles for spirits. In 1909, after decades of controversy, the First Presidency is sued an official statement regarding this matter entitled, "The Origin of Man": 

Adam, our great progenitor, "the first man," was, like Christ, a pre-exis- tent spirit, and like Christ he took upon him an appropriate body, the body of a man, and so became a "living soul." The doctrine of the pre-existence,— revealed so plainly, particularly in latter days, pours a wonderful flood of light upon the otherwise mysterious problem of man's origin. It shows that man, as a spirit, was begotten and born of heavenly parents, and reared to maturity in the eternal mansions of the Father, prior to coming upon the earth in a temporal body to undergo an experience in mortality. It teaches that all men existed in the spirit before any man existed in the flesh, and that all who have inhabited the earth since Adam have taken bodies and become souls in like manner. 

It is held by some that Adam was not the first man upon this earth, and that the original human being was a development from lower orders of the animal creation. These, however, are the theories of men. The word of the Lord declares that Adam was "the first man of all men" (Moses 1:34), and we are therefore in duty bound to regard him as the primal parent of our race. It was shown to the brother of Jared that all men were created in the beginning after the image of God; and whether we take this to mean the spirit or the body, or both, it commits us to the same conclusion: Man began life as a human being, in the likeness of our heavenly Father. 

True it is that the body of man enters upon its career as a tiny germ or embryo, which becomes an infant, quickened at a certain stage by the spirit whose tabernacle it is, and the child after being born, develops into a man. There is nothing in this, however, to indicate that the original man, the first of our race, began life as anything less than a man, or less than the human germ or embryo that becomes a man.[1]

Some have suggested this statement takes an anti-evolution stance. However, the First Presidency's statement doesn't address the mutability of species. Some have also claimed that since Adam is to be regarded "as the primal parent of our race," this rules out the possibility of evolution. Race, however, is not a biological distinction. James C. King, of the New York University School of Medicine, notes: 

What constitutes race is a matter of social definition. Whatever a group accepts as part of itself is within the pale; what it rejects is outside. Acceptance and rejection are not absolute but can exist in various degrees. . . . 

. . .[T]he fact [is] that what constitutes a race and how one recognizes a racial difference is culturally determined. Whether two individuals regard themselves as of the same or of different races depends not on the degree of similarity or their genetic material but on whether history, tradition, and personal training and experience have brought them to regard themselves as belonging to the same groups or to different groups. . . .[G]roup differentiation [is].. .based on cultural behavior and not on genetic difference.[2]

Therefore, Adam can be the "primal parent of our race"—or cultural group—without discarding the evolutionary model. When it was recognized that the First Presidency's statement didn't address the origin of man's physical body, questions among members persisted. Less than six months after the official "statement," the following information was printed in the April 1910 Improvement Era: 

Whether the mortal bodies of man evolved in natural processes to present perfection, thru the direction and power of God; whether the first parents of our generations, Adam and Eve, were transplanted from another sphere, with immortal tabernacles, which became corrupted thru sin and the partaking of natural foods, in the process of time; whether they were born here in mortality, as other mortals have been, are questions not fully answered in the revealed word of God.[3]

Thus, three possibilities were suggested for the creation of man's physical body: 1) evolution via a natural process as directed by the power of God; 2) transplantation from another sphere; 3) birth in mortality by other mortals. None of these three fits the typical "creationist" model. 

Because the official "statement" didn't resolve the issues of evolution or the mutability of species, the controversy among members, and even BYU faculty members, continued. Evolution was being taught by faithful LDS professors at BYU, while other BYU professors (and at times, students or parents of students) opposed such teaching.[4] In 1911 the controversy grew more intense, and several BYU faculty members became embroiled in this issue, resulting in bitter feelings and even some changes of employment.[5]

The 1911 BYU controversy prompted President Joseph F. Smith to conclude that "evolution would be best left out of discussions in our Church schools."[6] The matter was pushed to a back burner. While President Smith personally believed that the theory of evolution was an "hypothesis" and "more or less a fallacy," he also stated that the church was "not undertaking to say how much of evolution is true, or how much is false" and that "the Church itself has no philosophy about the modus operandi employed by the Lord in His creation of the world."[7] Then in 1913, in a conference address in Arizona, President Smith added another interesting comment to the issue: 

Man was born of woman; Christ, the Savior, was born of woman and God, the Father, was born of woman. Adam, our earthly parent, was also born of woman into this world, the same as Jesus and you and I.[8]

Six years later Heber J. Grant became president of the church. After six years of serving in office, President Grant saw a need to reiterate the 1909 official statement on "The Origin of Man" with a few modifications. The First Presidency's " 'Mormon' View of Evolution" reaffirmed the divinity and role of Jesus Christ, that Adam was "our great progenitor, 'the first man,'" and that "the doctrine of pre-existence pours a wonderful flood of light upon the otherwise mysterious problem of man's origin." The statement also reaffirmed that man is a "child of God, formed in the divine image and endowed with divine attributes."[9]

Sixteen years earlier, the original 1909 statement had concluded: "It is held by some that Adam was not the first man upon this earth, and that the original human being was a development from lower orders of the animal creation. These, however, are the theories of men." As already noted, some people incorrectly interpreted this as an anti-evolution comment. This ambiguous comment was no longer found in the 1925 statement. 

Some of the Apostles had taken an interest in this controversial subject, and they were not always in agreement with one another. Joseph Fielding Smith was opposed to evolution, whereas B. H. Roberts was more open to the possibility. During the mid 1920s, Elder B. H. Roberts began compiling notes for a book on church history and doctrine. In 1927 he began developing his notes into what he hoped would be a study course for the seventies throughout the church.[10] Roberts believed that 'Adam represented the beginning of the Adamic Dispensation, but before him, a whole race of human beings had lived and died on earth. These 'pre-adamites' were simply destroyed in a great cataclysm that 'cleansed' the earth before Adam, leaving only fossilized remains as the meager evidence of their presence."[11] To Roberts, the evidence for pre Adamites was overwhelming. In 1928 he finished his magnus opus and sometime later submitted it to the publication committee, consisting of five apostles, who rejected his work primarily because of his reference to pre-Adamites. Roberts was told it might be possible to print his book, with modifications, but he refused the suggestion. 

In April 1930, speaking to a genealogical conference, the young Apostle Joseph Fielding Smith—while admitting that the Lord had not revealed the method of creation—denounced the belief in death or mortal existence before the fall: "The doctrine of 'pre-Adamites' is not a doctrine of the Church, and is not advocated nor countenanced in the Church." Smith's talk was reprinted in the October 1930 Utah Genealogical and Historical Magazine.[12] When Smith's comments came out in print, B. H. Roberts complained to the brethren, challenging the validity of Joseph Fielding's claims. Smith's views were now on public record, whereas Roberts's views were still confined to his unpublished manuscript. Three months later, the Quorum of the Twelve reviewed both Smith's and Roberts's arguments. During this time, Apostle James Tal mage, a trained biologist, took interest in the topic and apparently was "sympathetic to much of the spirit of Roberts's efforts."[13] After some denunciation of Smith's geological sources, Talmage "made it clear to his assembled brethren that all reputable geologists recognized the existence both of death and 'pre-Adamites' prior to 6,000 years ago, the presumed date of the fall of Adam."[14] Smith of course disagreed, but the First Presidency took a position of neutrality by stating: 

The statement made by Elder Smith that the existence of pre-Adamites is not a doctrine of the Church is true. It is just as true that the statement: 'There were not pre-Adamites upon the earth' is not a doctrine of the Church. Neither side of the controversy has been accepted as a doctrine at all. 

Both parties make the scripture and the statements of men who have been prominent in the affairs of the Church the basis of their contention; neither has produced definite proof in support of his views.. . . 

Upon the fundamental doctrines of the Church we are all agreed. Our mission is to bear the message of the restored gospel to the people of the world. Leave Geology, Biology, Archaeology and Anthropology, no one of which has to do with the salvation of the souls of mankind, to scientific re search, while we magnify our calling in the realm of the Church. . . .[15]

The brethren thus suggested that Smith and Roberts drop the issue. Talmage, who had not been part of the publication committee which had reviewed and rejected Roberta's book, was now drawn into the discussion because the issue was brought before the entire Quorum of the Twelve.[16]

Talmage had devoted much of his adult life to harmonizing science and religion. In 1884, while attending John Hopkins University, Talmage listened to a Methodist preacher denounce the "evils of Darwinism." Following the lecture, Talmage wrote in his journal: "'[B]elief in a loving God perfectly accords with my reverence for science, and I can see no reason why the evolution of animal bodies cannot be true—as indeed the facts of observation make it difficult to deny—and still the soul of man is of divine origin.'"[17] Following his college years, Talmage seems to have eventually rejected the evolution of man for lack of evidence, but not for any scriptural reasons. He did, however, believe in pre-Adamites. 

Taking a position of neutrality, the First Presidency requested that the issue be dropped from public discourse. James Talmage, who was at the meeting in which the presidency discussed their decision, wrote in his diary: "This is one of the many things upon which we cannot speak with assurance and dogmatic assertions on either side are likely to do harm rather than good."[18] Unfortunately, Smith's talk—and position— had already been published, and Talmage, as well as others, found that many students " 'inferred from Elder Smith's address that the Church refuses to recognize the findings of science if there be a word in scriptural record in our interpretation of which we find even a seeming conflict with scientific discoveries or deduction, and that therefore the "policy" of the Church is in effect opposed to scientific research.'"[19] In fact, Tal mage recorded in his journal that an unnamed member of the First Presidency felt that "'sometime, somewhere, something should be said by one or more of us to make plain that the Church does not refuse to recognize the discoveries and demonstrations of science, especially in relation to the subject at issue.'"[20]

In August 1931, that "something" came from James Talmage. The geologist-trained apostle delivered a talk in the tabernacle entitled "The Earth and Man/' wherein he discussed "fossil remains of plants and animals" which, according to scientists, point to "a very definite order in the sequence of life embodiment." "These primitive species," explained Tal mage, "were aquatic; landforms were of later development. Some of these simpler forms of life have persisted until the present time, though with great variation as the result of changing environment." Talmage also referred to the studies of geologists which demonstrated that "very simple forms of plant and animal bodies were succeeded by others more complicated; and in the indestructible record of the rocks they read the story of advancing life from the simple to the more complex, from the single-celled protozoan to the highest animals." While never directly mentioning evolution, Talmage's choice of words suggests he was open to the possibility. As for the beginning of mankind, Talmage wrote: "In due course came the crowning work of this creative sequence, the advent of man!" 

While Talmage did believe in pre-Adamites, he wasn't as sure regarding the connection between these beings and "man." He said he did not regard 'Adam as related to—certainly not as descended from—the Neanderthal, the PG Cro-Magnon, the Peking or the Piltdown man." Tal mage also recognized that we did not, as yet, have all the information. "Discrepancies that trouble us now will diminish as our knowledge of pertinent facts is extended. The creator has made record in the rocks for man to decipher; but He has also spoken directly regarding the main stages of progress by which the earth has been brought to be what it is. The accounts can not be fundamentally opposed; one can not contradict the other; though man's interpretation of either may be seriously at fault."[21]

After much discussion among the brethren (during which Talmage sent a letter to John A. Widtsoe, who replied with words of encouragement), and following a few minor modifications, Talmage's talk was printed in the November 1931 Deseret News, as well as in a separate church pamphlet at about the same time (the "pamphlet" was referred to in the original Deseret News article). It was reprinted again in the December Millennial Star. Then, in December 1965 and January 1966, it was printed as a two-part article in the Instructor. 

Accounts vary as to what directive, if any, Talmage had been given concerning the topic, content, and publication of his talk. Historian James B. Allen believes that Talmage gave his talk "at the request of the First Presidency."[22] According to Talmage's diary, President Anthony W. Ivins (first counselor in the First Presidency) as well as three other members of the Council of the Twelve—including Joseph Fielding Smith— were present during his talk. And while the brethren recognized that Talmage's remarks were contrary to Smith's earlier address, the other brethren (excepting Smith) expressed their "tentative approval" of what Talmage said in the address.[23]

However, in 1935 President Heber J. Grant and his two councilors sent a reply to Sterling Talmage, son of (now deceased) James Talmage, claiming that it was President Ivins (also now deceased) who disagreed with the view of Joseph Fielding Smith and who had arranged for Tal mage to deliver his talk in a meeting over which Ivins presided. According to this letter, Grant claimed that all but one of the Quorum of the Twelve were against publishing Talmage's talk. Finally, however, Ivins saw to the printing of the address without the consent of President Grant. Grant was quick to point out in his letter that he was not condemning the material in Talmage's lecture, but rather that the address was not officially sanctioned by the church. "This does not mean that his [Talmage's] views are not orthodox," wrote the First Presidency, "they may or may not be; it only means that whether or not, they are not the official utterances of the Church and are not binding upon the Church and stand only as the well-considered views of a scholar and an apostle of the Church."[24]

This letter to Sterling Talmage suggests that the publication of Tal mage's talk was not only opposed by most of the brethren, but had been published without the consent of the First Presidency. However, this contradicts James Talmage's diary entry on November 21, wherein he recorded that his address had "come under consideration. . .investigation. . .[and] discussion" by the "First Presidency and the Council of the Twelve." Talmage wrote in his diary that "the majority of the Twelve have been in favor of the publication of the address from the time they first took it under consideration."[25] Reed Smoot's journal likewise mentioned that a "majority" of the brethren favored printing the lecture with some minor changes.[26] Even Rudger Clawson's official report recorded that after Talmage agreed to make some modifications, the brethren adopted a motion to publish the address.[27] Finally, President Grant's own diary entry of November 17, 1931, contradicts his 1935 letter by noting that "'we. . .authorized its [Talmage's address] publication and also gave authorization for it to be printed in the same form as the radio addresses, for distribution.'"[28]

There are various theories as to why the accounts differ, but in the end we just don't know why there appear to be conflicting stories. When President Grant sent this letter to Sterling Talmage in 1935 (four years after his father's tabernacle address), James Talmage and the two original First Presidency councilors—Ivins and Charles Nibley—had all since passed away. Perhaps the accounts conflict due to failing recollection over the passage of time. Regardless, Talmage's presentation and publication of "The Earth and Man" was the only exposition of a Quorum member to have been reviewed and approved by at least some, if not all, of the First Presidency, and then published officially by the church. 

Meanwhile John Widtsoe had also taken interest in the topic of evolution. In 1927, Widtsoe gave a lecture at an outdoor institute for church school educators. One participant recorded: 

Brother John A. Widtsoe had courses, trying to provide these seminary men with a rational perspective on the relation of science and religion. . . .[Widtsoe] converted me to the biological theory of evolution. . . .1 thought. . .that the theory of evolution was cut and dried. But Brother Widtsoe in his very tentative and very cautious way didn't openly advocate it, but presented the theory so basically and so logically that, in part, it lead to my accepting [it].[29]

In 1934, three years after Talmage's tabernacle address, Widtsoe wrote a letter to Sterling Talmage: 

It is very likely that the time is ripe for someone to begin right now to prepare a wise, temperate, scientific statement on the doctrine of evolution, not forgetting the relationship of the doctrine to other good gospel doctrines. Our own views [Widtsoe and Sterling Talmage] with respect to evolution are fairly well known. Evolution as a law seems to me to have been demonstrated. Its metes [measures] and bounds are gradually being determined. 

As for the origin of man, or the origin of animals, or the origin of anything else, I do not see that science has given us any satisfactory answer so far. I accept without reservation the doctrine that man was a preexistent being who came to earth to inhabit a mortal body. How the body was created has not, as far as I know, been revealed to man.[30]

In another letter to Sterling three months later, Widtsoe added that he was cautious about the evolution of species, and he would "hold [his] judgement with respect to the origin of man in suspense" because "exist ing facts" did not satisfy his mind. Nevertheless, "[i]t would not hurt my feelings at all if in the wisdom of the Almighty the body of man was prepared in just the way you [Sterling] outline in your article ["Is Evolution a Faith-Promoting Principal?"], and then that the spirit of man, the eternal ego, was placed within the body so prepared."[31]

The church's decision to remain neutral on the topic of evolution prevented all of the brethren from getting church approval to publish anything official on the issue. Related topics, however, including the controversy over the age of the Earth, continued to appear in the official LDS magazine, the Improvement Era. By at least 1939, some of the magazine's articles began to discuss, once again, pre-Adamites and evolution. In 1943, Widtsoe published his Evidences and Reconciliations, wherein he wrote: 

The law of evolution or change may be accepted fully. . . .It is nothing more or less than the gospel law of progress or its opposite. . . .The theory of evolution which may contain practical truth, should be looked upon as one of the changing hypotheses of science, man's explanation of a multitude of observed facts. It would be folly to make it the foundation of a life's philosophy.[32]

Widtsoe was also involved in writing several such articles for the Era. One such article, printed in 1948, was titled "Were There Pre Adamites?" In this article, Widtsoe continued to remain cautious as to the creation of man, but wrote, "[I]t must also be admitted that no one can safely deny that such manlike beings did at one time roam over the earth. . . .How all this was accomplished is not known. The mystery of the 'creation' of Adam and Eve has not yet been revealed."[33]

By 1952 the LDS scientist-leaders who were open to the possibility of evolution had all passed away, including James Talmage (died 1933), B. H. Roberts (1933), and John Widtsoe (1952). Apostle Joseph Fielding Smith, who still opposed a belief in pre-Adamites, was left with little opposition to his views. In 1953 he tested the waters by giving a public dis course at BYU entitled "The Origin of Man." A year later he published, without approval of then-prophet David O. McKay, a book on this subject, Man: His Origin and Destiny, which became widely accepted by church members. Researcher Duane E. Jeffery has noted: "The work marked a milestone. For the first time Mormonism had a book openly agnostic to much of science."[34] As Smith promoted his book, other LDS leaders were careful to point out that only the president of the church could declare doctrine. President J. Reuben Clark, Jr., second counselor in the First Presidency, delivered a speech entitled "When are the Writings or Sermons of Church Leaders Entitled to the Claim of Scripture?" just nine days after Smith presented his theories to Seminary and Institute teachers at BYU.[35] Smith's scientific theories were also criticized by eminent LDS scientist and dean of the University of Utah, Henry B. Eyring.[36] Others, however, came to Smith's support. Adding credibility to Smith's publication, Elder Sterling Sills said in the October 1954 conference: 

I hope I do not embarrass President Joseph Fielding Smith by speaking about his recent great book entitled Man: His Origin and Destiny which I think is one of the great books of the Church. I would like to see every person in the world read this great book, for what knowledge could be more important and helpful to man than the ideas therein presented. President Smith has packed into this book the study, meditation, and devotion of a lifetime, but through our reading we may make all of these ideas our own in a week or a month. This is one of the advantages of a great book.[37]

During the controversy over Smith's publication, William Lee Stokes, head of the Department of Geology at the University of Utah, wrote to President McKay inquiring about the church's position on Smith's theories. President McKay responded by noting: "On the subject of organic evolution the Church has officially taken no position. The book Man, His Origin and Destiny was not published by the Church and is not approved by the Church. The book contains expressions of the author's views for which he alone is responsible."[38] LDS historian Richard D. Poll and his wife also discussed Smith's book with President McKay and recorded McKay's comments: 

President McKay said that the book has created a problem. Being written by the president of the Quorum of the Twelve, it has implications which we can appreciate. The book has not been approved by the Church; we are authorized to quote him on that. The work represents the opinions of one man on the scriptures. Brother Smith's views have long been known. Striking the desk for emphasis, President McKay repeated that the book is not the authoritative position of the Church. He does not know how it came to be chosen as a text for the seminary and institute teachers last summer, but the choice was unfortunate.[39]

LDS historian Lowell Bennion recalls a similar meeting with McKay where the prophet told those present that Elder Smith's work " 'had not been authorized or approved, and that it did not represent the position of the church. . .on such matters as the age of the earth and the theory of evolution.' He added that, had he known in advance, ‘the book never would have been used as a text at the B.Y.U. summer session.'"[40] A concerned David O. McKay asked Adam S. Bennion, an apostle and former superintendent of church schools, to solicit responses to Elder Smith's book from qualified LDS scientists. Elder Bennion invited the opinions of Henry Eyring, geologist William Lee Stokes, and chemist Richard P. Smith. Eyring wrote to Bennion: "'I can understand 'Man—His Origin and Destiny' as the work of a great man who is fallible. . . .It contains many serious scientific errors and much ill humor, which mar the many beautiful things in it. Since the gospel is only that which is true, this book cannot be more than the private opinion of one of our great men.'"[41] Then in a 1973 interview, Eyring, when asked about the age of the Earth controversy, cited his disagreement with Smith's book, but added: 

I would say that I sustained Brother Smith as my Church leader one hundred percent. I think he was a great man. He had a different background and training on this issue. Maybe he was right. I think he was right on most things and if you followed him, he would get you into the Celestial Kingdom—maybe the hard way, but he would get you there. 

The Church, according to a letter from President McKay, has no posi- tion on organic evolution. Whatever the answer is to the question, the Lord has already finished that part of His work. The whole matter poses no problem to me. The Lord organized the world and I am sure He did it in the best way.[42]

Smith, however, was very adamant and vocal about his views, and by June 1955 there were rumors of a growing rift between Smith and President McKay. McKay despised controversy in the church and was not pleased with the controversy which Smith's book had created. Nevertheless, the prophet made no attempt to publicly or privately silence Elder Smith. Some LDS intellectuals recognized that there would be unavoidable differences of opinion on a variety of topics among members, and even among the brethren. Speaking to BYU students and faculty in 1958, Elder Hugh B. Brown said: 

Both religionists and scientists must avoid arrogant dogmatism... .Scientists and teachers of religion disagree among themselves on theological and other subjects. . . .Even in our own church men take issue with one another and contend for their own interpretations. But this free exchange of ideas is not to be deplored as long as men remain humble and teachable.[43]

Joseph Fielding Smith's son-in-law, Bruce R. McConkie, took sides with his father-in-law and in 1958 published Mormon Doctrine. Like Smith's book, Mormon Doctrine was widely accepted by members. Following on the heels of Smith's theories (nearly one-third of his references were to the ten books authored by Smith),[44] McConkie denounced evolution. "Those educational philosophies," he wrote in his 1958 compendium, "which deny Christ and the divine origin of man as an offspring of God (meaning especially the theories of organic evolution), are spawned and sponsored by Satan."[45] While McConkie's book appealed to LDS members in general, not all members or general authorities welcomed McConkie's new publication. 

From the perspective presented by the writings of Smith and McConkie, many members have come to the conclusion that the church is officially anti-evolution. However, there have been other publications through the years which should have dispelled such a myth. In 1965, for example, David Lawrence McKay, son of President McKay and member of the general church Sunday School superintendency, brought to the attention of his father an article by BYU botanist Bertrand Harrison which discussed organic evolution. McKay enjoyed the article enough to approve it for publication in the July 1965 Instructor. Bergera and Priddis note that this "was the most pro-evolution article to ever have appeared in an official church periodical."[46] By December of the same year, Tal mage's "The Earth and Man/' was reprinted in the Instructor as well. 

Bruce R. McConkie, however, continued to advance his anti-evolutionary views, and in 1980 listed evolution as one of the "seven deadly heresies."[47] Other apostles likewise favored the Smith-McConkie view of evolution. In the October 1970 general conference, for instance, Elder Ezra Taft Benson said: 

If your children are taught untruths on evolution in the public schools or even in our Church schools, provide them with a copy of President Joseph Fielding Smith's excellent rebuttal in his book Man: His Origin and Destiny.[48]

For a more balanced or neutral perspective, we cite the words of then-prophet Spencer W. Kimball, who, speaking at an all-women's fireside, said: 

Man became a living soul—mankind, male and female. . . .We don't know exactly how their coming into this world happened, and when we're able to understand it the Lord will tell us.[49]

In 1971 Dallin Oaks replaced Ernest Wilkinson as BYU's president and quickly discovered the serious nature of the controversy over evolution among students and faculty. While Oaks took a balanced role, he allowed and defended the teaching of evolution at BYU.[50] BYU's current view toward evolution is expressed in a letter from Michael Whiting (a BYU professor who teaches evolution) to my friend Marc Schindler, who queried Whiting regarding an on-line discussion in which someone claimed that if evolution were "true" then it would be taught at BYU. Since it wasn't taught at BYU, this person claimed, then the church must have a problem with it. 

Michael Whiting To Marc Schindler, March 3, 2000 

Dear Marc, 

The topic of evolution is handled at BYU the same way as at other universities. I teach Zoology 475 (Evolutionary Biology) to about 150 students every semester, the course has been on the books for at least the last 15 years, and there is no indication that it will ever be done away with. The first presidency has given its approval of the course, and (wisely) allows the professors to teach it in line with the current theories and data in evolutionary biology. The group of evolutionary biologists at BYU has actually grown in the last 3 years, and we have one of the largest and most active graduate programs in Phylogenetic Systematics (essentially, organismal genealogy) in the country. And we most recently received a large infusion of money from the BYU administration to expand the evolutionary biology program to foster collaboration with statisticians and computer scientists. The only thing different about evolutionary biology at BYU is that I try to encorporate [sic] a few lectures on the history of the idea of evolution in the LDS faith within the courses I teach. So evolutionary biology is in fact one of the largest and most successful graduate programs at BYU (over the past three years my research colleagues and [I] brought in roughly 2 million dollars in external research grants, 48% of which is directly deposited in the church's coffers as "indirect costs"), and there are plenty of LDS faithful who are not upset at the notion of a creation that follows natural principles. 

So following the logic of the member who challenged you, since BYU does teach evolution and it is a very successful program at the "Lord's University," then it must be true. Though of course I detest such logic. 

Cheers, 

Mike[51]

Through the years, various LDS leaders have taken either one side or the other on the evolution issue. While anti-evolution articles or comments have occasionally appeared in the Ensign, some neutral and subtly pro-evolution articles have appeared as well. The most recent, and the most authoritative, words on the official LDS position on evolution are found in the Encyclopedia of Mormonism. This five-volume reference set printed in 1992 with the strictest of supervision by the brethren (overseen by Neal A. Maxwell and Dallin H. Oaks) and edited by Daniel H. Ludow, who was executive secretary of the Church Correlation Committee, contains two articles relevant to our topic. Under the Encyclopedia's heading, "Origin of Man," by LDS anthropologist, John L. Sorenson, we read: 

Many sympathetic to science interpret certain statements in LDS scripture to mean that God used a version of evolution to prepare bodies and environmental surroundings suitable for the pre-mortal spirits. . . .Certain statements of various General Authorities are also used by proponents of this idea to justify their opinions. 

Other Latter-day Saints accept a more literal reading of scriptural passages that suggest to them an abrupt creation. Proponents of this view also support their propositions with statements from scripture and General Authorities.[52]

Sorenson also notes that "the current state of revealed truth on the LDS doctrine of man's origin may permit some differences of opinion concerning the relationship of science and religion." 

Under the title "Evolution," we find an article by William E. Even son, a BYU professor of physics, who worked through a long process to complete the article which was eventually used in the Encyclopedia. The article began as 1,000 words long but grew until it reached 4,500 words. Evenson relates that "finally, in the spring of 1991, the First Presidency and Quorum of the Twelve" reviewed the material and "decided that they wanted only a short article referring to the First Presidency statements on the subject, which are the only definitive source of Church doctrine. The resulting entry in the Encyclopedia is only 258 words long."[53] The article reads: 

The position of the Church on the origin of man was published by the First Presidency in 1909 and stated again by a different First Presidency in 1925: 

The Church of Jesus Christ of Latter-day Saints, basing its belief on divine revelation, ancient and modern, declares man to be the direct and lineal offspring of Deity. . . .Man is the child of God, formed in the divine image and endowed with divine attributes. . . . 

The Scriptures tell why man was created, but they do not tell how, though the Lord has promised that he will tell that when he comes again (D&C 101:32-33). In 1931, when there was intense discussion on the issue of organic evolution, the First Presidency of the Church, then consisting of Presidents Heber J. Grant, Anthony W. Ivins, and Charles W. Nibley, addressed all of the general authorities of the Church on the matter, and concluded: 

Upon the fundamental doctrines of the Church we are all agreed. Our mission is to bear the message of the restored gospel to the world. Leave geology, biology, archaeology, and anthropology, no one of which has to do with the salvation of the souls of mankind, to scientific research, while we magnify our calling in the realm of the Church. . . . 

Upon one thing we should all be able to agree, namely that Presidents Joseph R Smith, John R. Winder, and Anthon H. Lund were right when they said, 'Adam is the primal parent of our race" [First Presidency Minutes, Apr. 7,1931].[54]

Evenson notes that "the role of organic evolution in the development of life on earth is a good example of an issue that is not settled in the Church."[55]

In the same year that the Encyclopedia of Mormonism was published (1992), Evenson was asked to put together a packet on evolution for BYU students who were interested in the church's position. The contents of this packet were formally approved by the BYU Board of Trustees, which included the First Presidency, a majority of the Quorum of the Twelve, and several other general authorities.[56] This packet, which is still available at the BYU library as well as on the internet,[57] contains the first three First Presidency statements on the subject (1909, 1910, and 1925) as well as the article on evolution from the Encyclopedia of Mormonism.[58] The cover page to this packet notes: "Although there has never been a formal declaration from the First Presidency addressing the general matter of organic evolution as a process for development of biological species, these documents make clear the official position of the Church regarding the origin of man" (emphasis in original). 

Ironically, while the official LDS position on evolution is neutral, the majority of evolution-related comments appearing in official church publications have been hostile to evolution.[59] For example, in the 1980/81 Melchizedek Priesthood study guide, in a lesson entitled "The Divine Origin of Man," the manual quotes Joseph Fielding Smith's Seek Ye Earnestly: "Now, evolution leads men away from God. Men who have had faith in God, when they have become converted to that theory, for sake him."[60]

More recently, two other articles suggesting hostility to a neutral stance on evolution can be found in the Teachings of the Presidents of the Church: Joseph F. Smith and in the February 2002 Ensign. In the Teachings of the Presidents of the Church, which was the instruction manual for the Melchezidek Priesthood and Relief Society for the year 2001, we find selected portions of the 1909 First Presidency statement on the "Origin of Man" which hint that acceptance of evolution is contrary to the gospel.[61] In the February 2002 Ensign, we find a reprint of the same 1909 First Presidency statement without noting the 1910, 1925, 1931 statements, or the Encyclopedia of Mormonism additions to the topic.[62] To Ensign readers un familiar with the additional insights added in these post-1909 statements, the reprinted 1909 statement may imply a rejection of evolution on gospel grounds. 

Like other myths, both inside and outside the church, the myth of "evil evolution" is perpetuated by the masses who are unfamiliar with information which refutes such falsehoods. The topic of evolution is not unique in this aspect. For instance, while readers of Dialogue are aware that President George Albert Smith refuted the June 1945 "Ward Teachers' Message" which claimed that "when our leaders speak, the thinking has been done,”[63] many Latter-day Saints are not only unaware of President Smith's refutation of the statement, but some Saints repeat the declaration as if it were doctrinal. Similarly, a 1985 survey conducted by Richley Crapo at the University of Utah, found that a number issues which are accepted or rejected by members at a "grass roots" level are contrary to official LDS positions.[64] On the subject of evolution, for instance, Crapo's survey discovered that 57 percent of those polled believed that the official LDS position was anti-evolution, and only 38 percent correctly identified the official position as neutral. 25 percent of those who personally accepted evolution believed that their views were contrary to a supposed official anti-evolution position of the church, and 70 percent of those who rejected evolution believed that this was the official church stance on the subject.[65]

While a greater number of Latter-day Saints will read Ensign articles which generally disesteem evolution, there is some comfort in the fact that in addition to the aforementioned Encyclopedia of Mormonism articles and the BYU evolution packet, other conservative albeit less familiar LDS publications are more liberal in their approach to organic evolution. BYU Studies and FARMS Review of Books, for example, tend to express an overwhelming pro or neutral stance toward the topic.[66]

The popularity of these alternate sources of LDS-related publications, as well as publications such as Dialogue and Sunstone and the mushrooming growth of the LDS-information-websites—many of which advance a neutral or pro position to evolution[67]—suggests that in time we may see the demise of the Mormon myth that teaching or accepting evolution amounts to apostasy.[68]

---

[1] Improvement Era, November 1909, 75-81. 

[2] James C. King, The Biology of Race (N.Y.: Harcourt Brace Jovanovich, Inc., 1971), 160, 163. See also http://www.standard.net/standard/news/news_story.html?sid=20010628232006.6C A90+cat=news+ternplate=newsl.html

[3] Improvement Era, April 1910, 570. Although there was no author's name attached to this statement, a number of scholars have suggested that Joseph F. Smith was responsible for the material since he and Edward H. Anderson were the editors (see Duane E. Jeffery, "Seers, Savants and Evolution: The Uncomfortable Interface," Dialogue 8 (Autumn/Winter 1973): 60; David John Buerger, "The Adam-God Doctrine," Dialogue 15 (Spring 1982): 41; Erich Robert Paul, Science, Religion, and Mormon Cosmology [Urbana and Chicago: University of Illinois Press, 1992], 175). 

[4] Gary James Bergera and Ronald Priddis, Brigham Young University: A House of Faith (Salt Lake City: Signature, 1985), 150. 

[5] Ibid., 134-48. 

[6] The Juvenile Instructor 46 (April 1911): 208.

[7] Ibid., 208-9. 

[8] Deseret News, December 27, 1913, sec. Ill, p. 7; reprinted in the Church News section of Deseret News, September 19, 1936, pp. 2, 8; quoted in Jeffery, "Seers, Savants and Evolution," 62. 

[9] Editors' Table, Improvement Era 28 (September 1925): 1090-91 

[10] Richard E. Sherlock and Jeffrey E. Keller, " 'We Can See No Advantage to a Continuation of the Discussion': The Roberts /Smith/Talmage Affair," Dialogue 13 (Fall 1980): 63.

[11] Ibid., 65. 

[12] Joseph Fielding Smith, "Faith Leads to a Fulness of Truth and Righteousness," Utah Genealogical and Historical Magazine 21 (Oct. 1930): 145-58; quoted in Jeffery, "Seers, Savants and Evolution," 63. 

[13] Sherlock and Keller, "We Can See No Advantage," 98. 

[14] Ibid., 99.

[15] Quoted in Jeffery, "Seers, Savants and Evolution," 64. 

[16] Jeffrey E. Keller, "Discussion Continued: The Sequel to the Roberts/Smith/Talmage Affair," Dialogue 15 (Spring 1982): 81. 

[17] Ibid., 81. 

[18] April 7, 1931, reprinted in The Essential James E. Talmage, ed. James P. Harris (Salt Lake City: Signature, 1997), 237. 

[19] Talmage Journals, Nov. 21,1931, quoted in Keller, "Discussion Continued," 84.

[20] Keller, "Discussion Continued," 84.

[21] James A. Talmage, "The Earth and Man," address delivered in the Tabernacle, Salt Lake City, Utah, Sunday, August 9,1931; also available on-line at http://www.fri.com/~allsop/eyring-l/faq/evolution/Talmage/1931.html

[22] James B. Allen, 'The Story of The Truth, The Way, The Life" BYU Studies 33 (1993): 727. 

[23] April 5,1930; reprinted in Harris, The Essential Talmage, 239. 

[24] Reprinted in Sterling B. Talmage, Can Science Be Faith-Promoting?, ed. Stan Larson (Salt Lake City: Blue Ribbon Books, 2001), 245. 

[25] April 5,1930; in Harris, The Essential Talmage, 239; emphasis added.

[26] Keller, "Discussion Continued," 39.

[27] Ibid., 86-87. 

[28] Heber J. Grant Diary, 16 and 17 November 1931, according to typescript in Strack Collection; quoted by Stan Larson, ed., in Talmage, Can Science Be Faith Promoting?, lviii (emphasis added). 

[29] "The Twentieth Annual Convention of Teachers in the Schools and Seminaries of the Church of Jesus Christ of Latter-day Saints," 21-22 Oct. 1925, Brimhall Papers, quoted in Bergera and Priddis, BYU: A House of Faith, 150.

[30] April 20,1934, reprinted in Talmage, Can Science Be Faith-Promoting?, 222-23.

[31] July 17,1934, reprinted in ibid., 228-29. 

[32] John A. Widtsoe, Evidences and Reconciliations, 156. 

[33] John A. Widtsoe, "Evidences and Reconciliations," Improvement Era, May 1948, 205.

[34] Jeffery, "Seers, Savants and Evolution," 65. 

[35] Ibid., 66. 

[36] See Steven H. Hatch, "The Reconciliation of Faith and Science: Henry Eyring's Achievement," in Dialogue 15 (Autumn 1982): 89. 

[37] Conference Report, October 1954, 28. 

[38] McKay to Stokes, February 15,1957, cited in William Lee Stokes, "An Official Position," in The Search for Harmony Essays on Science and Mormonism, ed. Gene A. Sessions and Craig J. Oberg (Salt Lake City: Signature Books, 1993), 291-94.

[39] Richard D. Poll, "The Swearing Elders: Some Reflections: A Response to Thomas Blakely," Sunstone 10 (January 1986): 16. 

[40] George T. Boyd, ""Notes from an Interview with President David O. McKay," March 1955, as quoted in Bergera and Priddis, BYU: A House of Faith, 154n.

[41] Quoted in Hatch, "Reconciliation of Faith and Science," 89.

[42] Edward W. Kimball, "A Dialogue With Henry Eyring," Dialogue 8 (Autumn/Winter 1973): 103. 

[43] Hugh B. Brown, "What Is Man and What He May Become," 24 March 1958, in Speeches, 1957-58, quoted in Begera and Priddis, BYU: A House of Faith, 157.

[44] Bergera and Priddis, BYU: A House of Faith, 157-8. 

[45] Bruce R. McConkie, Mormon Doctrine (Salt Lake City: Bookcraft, 1958), 180.

[46] Bergera and Priddis, BYU: A House of Faith, 159. 

[47] Bruce R. McConkie, "The Seven Deadly Heresies," BYU fireside at the Marriott Center June 1,1980; transcript available on-line at http://www.coolcontent.com/McConkie/heresies.html

[48] Conference Report, October 1970, 49. 

[49] Spencer W. Kimball, "The Blessings and Responsibilities of Womanhood," 1 Oct. 1975, printed in Ensign, March 1976, 72. 

[50] See Bergera and Priddis, BYU: A House of Faith, 161-68; also available online at http://www.fri.com/~allsop/eyring-l/faq/evolution/Relatedness_1965.html

[51] About.com, LDS Apologetics message board; "The Question," #71, 2608.71 in reply to 2608.64; online at http://forums.about.com/n/mb/message.asp?webtag=ab-lds&msg=2608.71. Michael Whiting and BYU undergraduate, Taylor Maxwell, were responsible for the 16 January 2003 cover story for the scientific journal, Nature. Using some of the latest DNA re searching techniques, Whiting and Maxwell discovered revolutionary information which enhances the study of evolutionary biology. ("Loss and Recovery of Wings in Stick Insects," Nature, 421: 264-267.)

[52] Ludlow, Daniel H. et al., eds., Encyclopedia of Mormonism: The History, Doctrine, and Procedure of The Church of Jesus Christ of Latter-day Saints, 4 vols. (New York: Macmillan, 1992)3:1053. 

[53] William E. Evenson, "LDS Doctrine and the Theory of Evolution," cited by Stan Larson, ed., in Talmage, Can Science Be Faith Promoting?, xxxi.

[54] Encyclopedia of Mormonism 2:478. 

[55] Evenson, cited by Larson, ed., in Talmage, Can Science Be Faith Promoting?, xxxii.

[56] Ibid., xxxiii and nn 5 and 6. 

[57] See http://zoology.byu.edu/zool475/pdf%20files/Evolution%20Packet.pdf and http://eyring.hplx.net/Eyring/faq/evolution/trusteesl992.html 

[58] Evenson, cited by Larson, ed., in Talmage, Can Science Be Faith Promoting?, xxxii n6.

[59] For example, a search for stances on evolution as recorded in the past thirty years of church publications yielded some lopsided results. I was able to find ten instances wherein a given LDS speaker/author expressed hostility towards evolution: see Elder Ezra Taft Benson, "The Book of Mormon is the Word of God," Ensign, May 1975, 63 ff; Elder Bruce R. McConkie, "The Glorious Gospel in Our Day," Tambuli, April 1980, 82 ff; Elder Bruce R. McConkie, "Christ and the Creation," Tambuli, Sept. 1983, 22 ff; Elder Boyd K. Packer, "The Pattern of Our Parentage," Ensign, Nov. 1984, 66 ff; Bruce R. McConkie, "The Caravan Moves On," Ensign, Nov. 1984, 82 ff; Elder Russell M. Nelson, "The Magnificence of Man," Ensign, Oct. 1987, 44 ff; Robert L. Millett, "So Glorious a Record," Ensign, Dec. 1992, 6ff; Elder George R. Hill, III, "Seek Ye Diligently," Ensign, June 1993, 21 ff; Lisa M. G. Crockett, "Roots and Branches," New Era, August 1999, 28 ff; "Gospel Classics: The Origin of Man," Ensign, Feb. 2002, 26ff. In contrast, I found six comments on evolution that were either liberal, neutral, or open-ended: see Dr. Sherwood B. Idso, "Visitors from Outer Space—Meteorites," Friend, Jan. 1979,11 ff; F. Kent Nielsen, "The Gospel and the Scientific View: How Earth Came to Be," Ensign, Sept. 1980, 67 ff; George A. Horton, Jr., "A Prophet Looks at Genesis; Insights from the Joseph Smith Translation" Ensign, Jan. 1986, 38 ff; Don Lind, "Things Not Seen," Tambuli, June 1987, 42 ff; Morris S. Peterson, "Questions and Answers: Do We Know How the Earth's History as Indicated from Fossils Fit with the Earth's History as the Scriptures Present It?" Tambuli, April 1988, 29 ff; Robert J. Woodford, "In the Beginning: A Latter-day Perspective," Ensign, Jan. 1998,12 ff. 

[60] "The Divine Origin of Man," Choose You this Day: Melchizedek Priesthood Personal Study Guide 1980-81 (Salt Lake City: The Church of Jesus Christ of Latter-day Saints, 1979), 39; see also Joseph Fielding Smith, Seek Ye Earnestly (Salt Lake City: Deseret Book Co., 1970), 283. 

[61] "Sons and Daughters of the Eternal Father, From the Life of Joseph F. Smith," ch. 37 in Teachings of Presidents of the Church: Joseph F. Smith (Salt Lake City: The Church of Jesus Christ of Latter-day Saints, 1998), 331 ff. 

[62] "Gospel Classics: The Origin of Man," Ensign, Feb. 2002, 26 ff.

[63] Ward Teachers' Message for June 1945, "Sustaining the General Authorities of the Church/' Improvement Era, June 1945,. 354. For President Smith's refutation of the idea, which he said did "not express the true position of the Church," see "A 1945 Perspective," an accompaniment to L. Jackson Newell's 'An Echo From the Foothills: To Marshal the Forces of Reason," Dialogue 19 (Spring 1986): 36-38; emphasis in original. 

[64] Richley H. Crapo, "Mormonism and Evolution," working draft for the August 2001 Sunstone Symposium, originally posted to Mormon-L and reposted August 13, 2001 on Eyring-L ([email protected]). Copy of repost in author's possession. 

[65] Richley H. Crapo, "Grass-Roots Deviance From Official Doctrine: A Study of Latter-day Saint (Mormon) Folk-Beliefs," at http://cc.usu.edu~FATH6/grassrts.htm. See also Crapo, "Mormonism and Evolution" (ibid.). 

[66] See Nissim Wernick, "Man, the Pinnacle of Creation," BYU Studies 10 (Autumn 1969), 31 ff; Hollis R. Johnson, "Civilizations Out in Space," BYU Studies 11 (Autumn 1970), 3 ff; Richard Sherlock, book review of Neal Gillespie, Charles Darwin and the Problem of Creation, in BYU Studies 22 (Winter 1982), 119 ff; A. Lester Allen, "Science and Theology: A Search for the Uncommon Denominator," BYU Studies 29 (Summer 1989), 71 ff; Scott Wol ley review of The Book of Mormon: Jacob through Words of Mormon, to Learn with Joy, eds., Monte S. Nyman and Charles D. Tate, Jr., in FARMS Review of Books, 3 (1991): 106; Michael F. Whiting, review of Clark A. Peterson, Using the Book of Mormon To Combat Falsehoods in Organic Evolution, in FARMS Review of Books, 5 (1993): 212; Daniel C. Peterson, "Editor's Introduction: Doubting the Doubters," FARMS Review of Books, 8, no. 2 (1996): x.

[67] For a few examples see http://www.cs.umd.edu/users/seanl/stuff/Evolution.html, http://www.etungate.com/Evolution.htm, and http://zoology.byu.edu/bioethics/chapter4.htm. 

[68] Special thanks to Marc Schindler for his helpful comments and suggestions.

[post_title] => The Mormon Myth of Evil Evolution [post_excerpt] => Dialogue 34.4 (Winter 2002): 19–38
In the years since this event, I've found that there are a number of members who believe that evolution is a doctrine of the devil. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => the-mormon-myth-of-evil-evolution [to_ping] => [pinged] => [post_modified] => 2024-01-28 17:17:15 [post_modified_gmt] => 2024-01-28 17:17:15 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10736 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10737 [post_author] => 1931 [post_date] => 2018-03-27 21:00:38 [post_date_gmt] => 2018-03-27 21:00:38 [post_content] =>

Introduction

In some sense, almost all Latter-day Saints (as well as members of numerous other faiths) would call themselves "creationists." They believe in a God who has overseen the creation of this and other worlds, and they believe that the universe, earth, and humans all have some transcendent purpose. A reasonably open-minded philosophy of this sort is entirely consistent with modern scientific knowledge. 

This paper will deal with a more specific form of creationism, which is often termed "creation science" or "scientific creationism" (these terms will be used synonymously). As defined in a 1981 Arkansas law, creation science is the belief in (1) sudden creation of the universe, energy, and life from nothing; (2) the insufficiency of mutation and natural selection in bringing about development of all living kinds from a single organism; (3) changes only within fixed limits of originally created kinds of plants and animals; (4) separate ancestry for man and apes; (5) explanation of the earth's geology by catastrophism, including the occurrence of a worldwide flood; and (6) a relatively recent inception of the earth and living kinds.[1] Advocates of this view, which is obviously Biblical literalism without explicit references to God, Adam, and Noah, hold that there was no life on earth before Eden (a few thousand years ago), and no death before the Fall of Adam. 

The creationist movement is currently very strong in the U.S. In a 1991 Gallup poll, 47 percent of the U.S. public, including 25 percent of college students, agreed that "God created man pretty much in his present form at one time within the last 10,000 years."[2] In the early 1980s Arkansas and Louisiana passed laws requiring equal treatment for creation science and evolution in public schools, although courts subsequently ruled these statutes to be unconstitutional. More recently, the Alabama legislature passed a law requiring that public school teachers, prior to discussing evolution, read a disclaimer that it is only a "controversial theory" believed by "some" scientists. It narrowly defeated a measure that would have required, among other things, that teachers instruct students to pencil in "theory only" beside any mention of evolution in textbooks, and "false data" beside any reference to radiocarbon dating. In Kansas, creationists elected a majority to the state school board, which removed mention of an old earth, macroevolution, or the big bang from the state school curriculum, although this action has now been reversed. In Louisiana, the House Education Committee approved a measure that links Darwinism with Hitler and racism. As this article is being written (May 2001), similar creationist efforts are active in Arkansas, Idaho, Michigan, Montana, Nebraska, Oklahoma, Pennsylvania, and Washington.[3]

Surveys of students at Brigham Young University indicate similar trends in the Church of Jesus Christ of Latter-day Saints. In 1935 only 36% of BYU students denied that humans had been "created in a process of evolution from lower life forms," but by 1973 the figure had risen to 81%. The results of a recent (2001) survey in an introductory biology course at BYU suggest that tension and uncertainty over these issues persist. Among students starting Biology 100 (freshmen biology for non majors), 48% agreed with a position that while "Evolution might apply to some limited circumstances, it does not occur across boundaries which separate major categories of plants and animals; it may apply to lower forms but not to man" (this was the fourth of five choices, with three more negative towards evolution and one more positive). 21% of these students expressed belief that the earth is only a few thousand years old, based on interpretation of scriptures (the second of five choices), and 50% agreed that creationism and evolution should be given equal time in public schools (the third of five choices). In a similar survey of Zoology 101 students (for freshman zoology majors), the corresponding percentages were 55%, 28% and 57%. For Zoology 475 (for upper-division zoology majors), the figures were 23%, 7% and 29%, respectively. In short, these figures paint a picture of freshmen LDS students who are largely confused and apprehensive about these issues, although much of this tension appears to be removed once students complete rigorous scientific coursework.[4] LDS faculty members at BYU are split on the question of evolution, with almost all in scientific departments affirming the conventional scientific picture, while many in the Department of Religion remain opposed. A popular LDS doctrinal commentary, written by a BYU religion professor, rules out evolution as irreconcilable with fundamental LDS beliefs and holds that there was no death before the Fall of Adam, which occurred only 7,000 years ago.[5]

Given these developments, many Latter-day Saints wonder if they should support the creationist movement. To better understand this issue, we shall examine the historical background of creationism, its connections to the LDS church, the scientific validity of its claims, and, finally, how the religious philosophy behind this movement relates to LDS theology and to modern Christian thought. 

Historical Background

Modern-day creationism, including, to some extent, the prevalence of creationist ideas within the modern LDS church, can be traced back to a nineteenth century religious movement which was the predecessor to today's Seventh-day Adventist denomination. 

The theory of evolution, which was first described in 1859 in Charles Darwin's Origin of the Species, initially sparked a backlash among many religious leaders. However, even by the end of the nineteenth century, Christians of various denominations began to acknowledge the basic framework of the evolutionary, old-earth worldview. They typically accommodated the facts of geology either by interpreting the "days" of Genesis to represent vast ages (the "day-age" theory) or by distinguishing a creation "in the beginning" from a subsequent creation in the Garden of Eden (the "gap" theory). Either way, Christians could accept the results of geological and paleontological research, while at the same time retaining their beliefs in the Bible as the Word of God. William Jennings Bryan, the outspoken lawyer who led the anti-evolution crusade in the 1920s, interpreted the "days" of Genesis as geological eras and allowed for limited evolution. 

At about this same time, the self-taught geologist George McCready Price started the modern creationist movement. Price was a devout member of the Seventh-day Adventist Church, which was founded in the nineteenth century by Ellen G. White. One of White's key teachings is that the fourth commandment mandates Saturday worship and a literal belief in Genesis. In one of her visions, she was shown that the creation week was "just like every other week." In subsequent writings she taught that Noah's flood was a worldwide event, and that after the flood waters had subsided, God caused "a powerful wind to pass over the earth," which buried the dead animals with trees, stone, and earth. These buried forests then became coal and oil, which God occasionally ignited to produce earthquakes and volcanoes.[6]

As a student who wrestled with the teachings of geology and biology, Price was intrigued by White's picture of the creation. In several books he subsequently authored, Price declared that much of modern science is "in the highest degree improbable and absurd." He focused his attack on geology, charging that geologists date rocks by their fossil content, while simultaneously determining the age of the fossils by their location in the geological column. Following White, Price asserted a recent creation and a literal Noah's flood. To Price, the flood explained why the fossils appear in a predictable sequence—the flood waters first killed smaller animals, followed by vertebrate fishes, and finally larger animals and man, who fled to the hilltops from the rising waters. Price, again echoing White's teachings, suggested that a miraculous "cosmic storm" buried their bodies. Thus the fossil record reveals merely a sorting of contemporaneous antediluvian life forms, and the conventional geological column is a delusion.[7] Price's book, The New Geology, which was first published in 1923, has sold over 15,000 copies.[8]

The most influential creationist work in recent decades is Whit comb's and Morris's The Genesis Flood, which was first published in 1961. Following the same overall outline as Price's works, this book starts with an affirmation of the authority and infallibility of the Bible. These authors argue, as did Price, that since the scriptures clearly describe a universal flood, Christian believers have only two choices: reject God's inspired Word or reject the testimony of thousands of professional geologists. According to the authors, God created the entire universe and populated the earth with fully grown plants, animals, and human beings, all in six literal days, using methods and processes completely different from those now in operation in the universe. There was no death before the Fall, so consequently all fossils are the remains of animals which perished subsequent to the Fall. The authors reject the conventional geological column as Price did, by attributing the apparent order of fossils to hydrodynamic sorting of organisms in the flood waters and the superior mobility of vertebrates. They acknowledge that by some indications the earth and the universe appear to be very old (for example, the evidence of light rays streaming to earth from stars millions of light years away), but an omnipotent Creator could easily have created them with the "appearance of age." One interesting item in this book is its mention of "human" footprints found together with dinosaur tracks near the Paluxy River in Glen Rose, Texas. This contradicts the notion that humans appeared many millions of years after dinosaurs became extinct.[9]

A more recent creationist work is Morris's Scientific Creationism, which was published in 1974. One of Morris's arguments for a young earth is based on space dust. Morris argues that if the moon is really as old as scientists claim, then it should be buried in over 180 feet of dust. Given that the astronauts found only a fraction of an inch, the moon (and the earth, by similar reasoning) must be much younger. Morris also argues that the second law of thermodynamics (a scientific principle that closed systems tend to evolve into increasingly disordered states) funda mentally forbids biological evolution.[10]

One other popular creationist work is Duane Gish's Evolution: The Fossils Say No! In this book Gish focuses on gaps in the fossil record. He argues that for some of these gaps, such as the transition between land mammals and sea mammals, it is biologically impossible that suitable intermediate species could exist.[11]

The LDS Connection

In the 1920s, LDS Apostle Joseph Fielding Smith became enamored with Price's writings. He was particularly impressed by Price's syllogism, "No Adam, no fall; no fall, no atonement; no atonement, no savior." He corresponded with Price, encouraging him in his efforts to defeat evolution, and then began writing a manuscript laying out what he regarded as the LDS case against evolution.[12]

In 1931 a dispute arose between LDS leaders Joseph Fielding Smith, Brigham H. Roberts, and James E. Talmage. Smith wanted to publish his anti-evolution manuscript, but Roberts wanted to publish his own manuscript, which acknowledged a conventional old-earth view and the existence of "pre-Adamites." In the course of these discussions, Smith promoted Price's book The New Geology. Talmage, as a degreed geologist, recognized the strength of evidence for modern geology and biology. While a student at Johns Hopkins University, he had recorded in his journal that he could see no reason "why the evolution of animal bodies cannot be true."[13] As a result, he was highly skeptical of Price's work, but lacking time to investigate he wrote to his son Sterling Talmage, a professor of geology and mineralogy at the New Mexico School of Mines. 

Sterling replied that The New Geology was not new, nor did it contain any real geology. He then quipped, "With these two corrections, the title remains the best part of the book." Sterling added that most of Price's arguments were "absurd."[14] Meanwhile the debate over evolution among the LDS leaders was stopped by the First Presidency, who declared in a letter, "Leave geology, biology, archaeology and anthropology, no one of which has to do with the salvation of the souls of mankind, to scientific research, while we magnify our calling in the realm of the Church."[15] 

In 1954, after Roberts and the senior Talmage had passed away, Joseph Fielding Smith reworked his manuscript on evolution into the book Man: His Origin and Destiny. In this book, Smith argued that not only is the theory of evolution unacceptable for doctrinal reasons, but— citing creationist writers such as Price—it is scientifically invalid as well.[16] David O. McKay, who was president of the church at the time (and who personally accepted the basics of biological evolution), reassured several people who wrote to his office that Joseph Fielding Smith's book contained only the author's opinion, and that the church did not have an official view on the subject of evolution.[17] Nevertheless, many of Smith's views were subsequently incorporated into his son-in-law Bruce R. McConkie's book, Mormon Doctrine, which today, nearly forty years after its original publication, remains the most widely cited LDS doctrinal reference.[18]

In the meantime, an LDS scientist gave a substantial boost to the nascent creationist movement. Dr. Melvin A. Cook, professor of metallurgy at the University of Utah and an internationally renowned explosives expert, was impressed by the arguments of Price, as well as by the teachings of Joseph Fielding Smith. After studying the technique of radiocarbon dating, he declared in 1961 that these dates should be telescoped down to a mere 13,000 years, in keeping with the notion that the seven days of creation each represent 1,000 years and that 6,000 years have transpired since creation. He was similarly critical of radiometric dating techniques and other underpinnings of modern geology. Other LDS scientists, including the renowned chemist Dr. Henry Eyring of the University of Utah, dismissed Cook's views, but Cook continued his work and subsequently published two creationist books.[19] Cook was invited to join the newly organized Creation Research Society, and he frequently published articles in its quarterly journal. Cook's international reputation lent substantial credibility to the Society. Cook was awarded the Nitro Nobel Gold Medal, which is granted periodically for outstanding contributions to the field of explosives, in the same year that his articles began to appear in Creation Research Quarterly. 

The New Creationism

Within the past few years a new group of creationists has arisen who have adopted a somewhat different strategy than their predecessors. They downplay some of the more controversial notions of creationism, such as flood geology and a recent six-day creation, and focus on a smaller set of fundamental notions, sanitized of explicit references to religious doctrine. According to U.C. Berkeley law professor Phillip Johnson, one of the central figures in this movement, the key notion of the creationist worldview is that there exists a personal Creator (an "Intelligent Designer") who is supernatural and who initiated and continues to control the process of creation, in furtherance of some end or purpose.[20] Collectively this new group of creationists are often referred to as intelligent design creationists (IDC), as distinguished from young-Earth creationists (YEC), a term used for the more traditional creationist community. 

Johnson argues that there is a fundamental and unproven dogma underlying much of modern science, especially evolution. This is the assumption of scientific naturalism, namely the philosophy that empirical nature is the only reality about which we can have solid knowledge. As a result, Johnson argues, the hypothesis that a God or an Intelligent Designer was involved in the creation of life on earth is, in effect, excluded from scientific discourse. He suggests that if scientists removed their naturalistic blinders, they might see the creation in an entirely new light.[21] Johnson frequently attacks the theory of evolution, arguing for example that the fossil record does not indicate smooth transitions between major branches of the biological kingdom.[22]

Another leader of the IDC school is Michael Behe of Lehigh University. He argues that certain biological features are "irreducibly complex," which means they are composed of several interacting parts, of which the removal of anyone would cause the system to cease functioning. He cites as examples the complex molecular machinery involved in vision, blood clotting, and movement of flagella. He then argues that it is im possibly unlikely that these components could have separately evolved, only later to fit into the unified system we see in an organism today.[23] In a similar vein, IDC creationist David Foster argues, drawing from an earlier work by astronomer Fred Hoyle, that the probability of forming the alpha-hemoglobin protein of human blood is so remote that it is extremely unlikely for it ever to have formed solely by natural evolution.[24]

Despite their outwardly open-minded approach to the creation, the IDC community has no tolerance for evolution, even theistic evolution, namely the belief that God directs the course of evolution. William Demb ski, a prominent IDC writer, makes this clear: "Design theorists are no friends of theistic evolution. As far as design theories are concerned, theistic evolution is American evangelicalism's ill-conceived accommodation to Darwinism."[25] Phillip Johnson is even more explicit: he describes the IDC strategy as a "wedge," designed to split the ranks of theistic evolutionists and others who hold that evolution is compatible with religion.[26]

The Scientific Evidence

Michael Ruse, a philosopher of science who testified in the 1981 Alabama creationism case, describes science as a discipline that (1) is guided by natural law; (2) is explanatory by reference to natural law; (3) is testable against the empirical world; (4) reaches conclusions that are tentative; and (5) is falsifiable.[27] How does creationism, new or old, measure as a scientific theory? For that matter, what is the status of the scientific view of the formation of the earth and life upon it? 

At this point in time, the conventional scientific picture of the earth as approximately 4.5 billion years old, with fossil remnants of the branching tree of creation extending from primitive bacteria in the distant past to flowering plants and vertebrates several hundred million years ago, and ultimately to homo sapiens during the past million or so years, is very well established. Geological dates are particularly well established, confirmed by numerous independent schemes, many of which rely on fundamental nuclear processes such as radioactivity and fission. These processes are well understood based on the laws of quantum mechanics. Quantum mechanical laws, in turn, are observed to be operating in distant stars, based on spectral measurements of light rays which departed the stars millions or even billions of years ago. Thus scientists have very good reasons to infer that these processes are completely reliable as clocks into the distant past. Biologist Kenneth Miller has observed, "The consistency of the data. . is nothing short of stunning."[28] Readable discussions of the dating schemes currently used by geologists are available from several sources.[29]

Until recently, paleontologists had to rely on a spotty fossil record to infer the course of evolution during past eras. Evolutionary closeness in the biological tree of life was often inferred by similarity in bone structure and organs, but in the past few decades, some powerful new tools have arisen, including comparisons of DNA and amino acid sequences. These new tools have confirmed, with very few exceptions, the traditional taxonomy of the biological world. Indeed, by carefully comparing DNA and amino acid sequences between different species, one can estimate relative times to evolutionary branching events in the past. To cite one well-known example: The 141-amino-acid-long alpha-hemoglobin molecule in humans is identical with that of chimpanzees, differs by one location in gorillas, by eighteen in horses, by twenty-five in rabbits, and by approximately one hundred locations in various fish species.[30]

As any responsible scientist will readily admit, the theory of evolution is still a theory in the sense that there are many details still to be pinned down. First, the origin of the earliest reproducing molecules and organisms is somewhat of a mystery, although some intriguing discoveries have been announced along this line in recent years.[31] Second, the specific course taken by the millions of known species, ancient and modern, will require many more years to be thoroughly understood. Third, the relative roles of natural selection, mutations, environmental change, and catastrophes (such as asteroid impacts) are still being debated. But the central notion that an evolutionary process has occurred over many millions of years is not seriously in doubt. 

With regard to the creationist theories, it should first be noted that while the YEC and IDC scholars write articles for their own creationist publications, as far as anyone can tell they have not yet attempted to publish articles in conventional, peer-reviewed scientific journals. What are we to make of some of the specific issues raised by creationists? There is not room in this paper to present a complete analysis of these claims, so I will comment briefly on just a few items. For further discussion of these issues, readers are referred to books by Eldredge, Miller, and Pennock.[32] There is also some interesting material in the Talk.Origins archive, which is located on the web at http://www.talkorigins.org. 

Space dust. As mentioned above, Henry Morris and others have argued that the moon can't be as old as ordinarily thought, because otherwise it would be covered with some 180 feet of dust. This claim is based on a 1960 study, published in Scientific American, of the space dust in fall rate, estimated from measurements made at the summit of Mauna Loa in Hawaii.[33] However, when the actual space dust flow rate was later directly measured by spacecraft, the result was lower by factor of more than 100. When this and other adjustments are made to the calculation, the result is completely consistent with what the astronauts found on the moon.[34]

These facts were made known to the creationist community at least twenty-five years ago, yet creationist speakers and authors continue to promote their argument. For example, it appears in the latest (2000) printing of Morris's Scientific Creationism.[35] This circumstance has prompted one scientist, himself a Christian theist, to comment, "The continuing publication of those claims by young-earth advocates constitutes an intolerable violation of the standards of professional integrity that should characterize the work of natural scientists."[36]

Paluxy River tracks. Whitcomb and Morris drew attention to "human" footprints and dinosaur tracks side-by-side near the Paluxy River in Texas. A team of anthropologists who subsequently examined this site found that the "human" footprints were 16 to 22 inches long. Subsequent analysis of subtle coloration effects confirmed that the "human" toe marks were dinosaurian. Based on such results, in 1988 an evangelical scientist wrote that it was no longer appropriate for creationists to use the Paluxy River tracks as evidence against evolution.[37] Nevertheless, the tracks are mentioned in the latest printings of The Genesis Flood (1998) and Scientific Creationism (2000), and they were also featured in the 1995 NBC broadcast Mysterious Origins of Man, narrated by Charlton Heston, which claimed that much of the traditional scientific account is false.[38]

The second law of thermodynamics. For years creationists have cited the second law of thermodynamics (a principle that closed systems tend to evolve to increasingly disordered states) as fundamental evidence that biological evolution cannot occur. However, those who cite it ignore or downplay the key condition, a "closed system," namely a system that has no influx or outflow of energy. The earth's biosphere is clearly not a closed system, since prodigious amounts of energy are received daily from the sun, and there is also heat generated by radioactive processes within the earth itself. This energy is more than enough to account for the evolution of life on earth. Indeed, life can be thought of as a process which creates order from its environment by extracting energy. Some creationists have discontinued using this argument, but it is promoted at length in the latest printing (2000) of Scientific Creationism, and it is also featured prominently in the museum of the Institute for Creation Research in San Diego.[39] Additional background on evolution and the second law of thermodynamics can be obtained from several sources.[40]

Gaps in the fossil record. Creationists have long assailed geologists and biologists for gaps in the fossil record. It is certainly true that gaps exist, particularly in sections of the geological column for which there are few accessible fossil sites. In addition, scientists now recognize that the fossil record documents periods of relative stability, punctuated with periods of rapid change. However, many of these gaps have been filled during the past few decades with discoveries of transitional fossils. These include several of the gaps which creationists Gish and Johnson claimed could not be bridged.[41]

Out-of-order fossil layers. In several locations, including a region of Montana and Canada, fossil layers appear out of their normal order, but these cases are readily explained by "over-thrusting," namely the movement of one section of rock over another, a phenomenon that can be verified by visual inspection.[42]

No observed speciation today. Creationists claim that since we do not observe new species arising today, it is speculation on the part of evolutionists to assert that this has happened throughout the history of the world. It is true that large-scale transitions have not been observed in historical times, doubtless due to the fact that they normally require many thousands of years, but several more modest speciation events have been documented.[43]

Irreducible complexity. IDC creationist Michael Behe's principal argument against evolution is that certain biological systems, such as vision or blood clotting, consist of multiple subsystems, the removal of any one of which would render the system nonfunctional. The main difficulty with this argument is that Behe does not convincingly establish that irreducibly complex systems cannot arise by natural evolution. As biologist Allen Orr explains, "an irreducibly complex system can be built gradually by adding parts that, while initially just advantageous, become—because of later changes—essential."[44] Miller points out that several specific examples highlighted by Behe have been studied at length by biologists, and credible evolutionary pathways have been identified.[45]

Probability. Some of the creationists' most impressive arguments against evolution involve probability calculations, so I will respond to this issue in some detail. One argument goes like this: The human alpha hemoglobin molecule, which plays a key oxygen transfer function, is a protein chain based on a sequence of 141 amino acids. There are twenty different amino acids common in living systems, so the number of different chains is 20141, or roughly 10183 (i.e., a one followed by 183 zeroes). If five billion years ago, all available material on the surface of the earth were organized into random generators of amino acid chains, then by now only about 1066 sequences would have been generated. Thus the probability that human alpha hemoglobin would have been produced is about 1066 +10183 = 1CH17, a fantastically small number. Thus no conventional theory of molecular evolution can account for the origin of human alpha-hemoglobin.[46]

However, this argument ignores the fact that most of the 141 amino acids can be changed without altering the key oxygen transfer function—witness that alpha-hemoglobin in fish differs by about one hundred locations from that of humans. When we revise the calculation above, based on only twenty-five locations essential for the oxygen transport function, we obtain 1033 fundamentally different chains. This is still a very large number, but it is vastly smaller than 10183. Biologists do not believe that alpha-hemoglobin arose by chance—more likely it arose via numerous intermediate steps—but nonetheless the above probability argument falls apart. It is at best inconclusive. 

Another way to better appreciate the difficulties with probability arguments (and also with arguments based on the second law of thermodynamics) is to consider snowflakes. Bentley and Humphrey's book Snow Crystals includes over 2000 high-resolution black-and-white photos of real snowflakes, many with intricate yet highly regular patterns.[47] What are the chances that one of these structures can form at random? We can calculate the probability that the pattern in one sector will be identical (to within a reasonable accuracy) with the five patterns in other sectors; it is roughly 102500. This probability figure is more extreme than any I have seen in anti-evolution literature. Further, the spontaneous formation of a snowflake appears to violate the second law of thermodynamics. Is this proof that God creates individual snowflakes? 

The fallacy in this line of reasoning is the fundamental assumption that a snowflake forms all at once as a random assembly of water molecules. It does not—it is the product of a long series of steps acting under physical laws of atomic interactions. A snowflake's six-way symmetry is merely a reflection of an underlying six-way symmetry in the molecular structure of water. Snowflakes also violate the second law of thermodynamics only if one ignores the fact that the formation of a snowflake requires a certain (very small) amount of energy. 

A naturalistic assumption. As noted above, one of Phillip Johnson's dominant themes is that underpinning much of modern science is an assumption of scientific naturalism, which excludes the hypothesis of an Intelligent Designer. Here science must respond, "Guilty as charged." One of the characteristics of the scientific methodology is that it seeks natural laws and processes to explain natural phenomena, and empirical tests are the arbiter of truth. This naturalistic methodology, while distasteful to some, forces the researcher to always press on in his or her search, and has proven to be an extremely fruitful approach for scientific investigation. 

By contrast, the hypothesis of an Intelligent Designer can be invoked literally anytime a scientist wishes: Nature must be this way because an Intelligent Designer made it that way, and it is futile (and possibly disrespectful) to seek any further explanation. At least the YEC community offers some concrete hypotheses, such as their claim that the creation of the earth took place approximately 6,000 years ago, producing all species of plants and animals currently on earth. These are testable hypotheses (and by any reasonable standard, they have been falsified), but the IDC community declines to describe its Designer, except to say that it is "omnipotent" (meaning not subject to the laws of the universe) and "in scrutable" (meaning utterly beyond our comprehension). Such hypotheses do not lead to empirically testable conclusions. Thus while the Intelligent Designer hypothesis may be an acceptable religious concept in some faiths, it is not an acceptable scientific notion.[48]

Creationism and LDS Theology

We have seen that creationism, old or new, fares rather poorly when measured against accepted standards of scientific research, but how does creationism fare from a religious point of view, and in particular from the perspective of LDS theology? 

As mentioned above, creationism is founded first and foremost on an infallible Bible. By contrast, the LDS church believes that while the Bible is the Word of God, there are several important caveats: (1) the Bible is incomplete, since revelation continues; (2) it has numerous errors of translation; (3) "plain and precious" material has been dropped; (4) certain segments (such as the Song of Solomon) are of dubious inspiration; (4) certain passages (such as Eve being formed from Adam's rib) should be interpreted figuratively; and (5) the Bible and other LDS scriptures are subject to official interpretation by the First Presidency—the scriptural texts themselves are not the final authority. With regard to figurative passages, Joseph Fielding Smith once wrote: 

Even the most devout and sincere believers in the Bible realize that it is, like most any other book, filled with metaphor, simile, allegory, and parable, which no intelligent person could be compelled to accept in a literal sense.. . . The Lord has not taken from those who believe in his word the power of 

reason. He expects every man who takes his "yoke" upon him to have common sense enough to accept a figure of speech in its proper setting, and to understand that the holy scriptures are replete with allegorical stories, faith-building parables, and artistic speech. . . .

Where is there a writing intended to be taken in all its parts literally? Such a writing would be insipid and hence lack natural appeal. To expect a believer in the Bible to strike an attitude of this kind and believe all that is written to be a literal rendition is a stupid thought. No person with the natural use of his faculties looks upon the Bible in such a light.[49]

With regards to the creation scriptures themselves, most LDS leaders have been reasonably flexible in their interpretations. For example, Brigham Young declared: 

As for the Bible account of the creation we may say that the Lord gave it to Moses, or rather Moses obtained the history and traditions of the fathers, and from these picked out what he considered necessary, and that account has been handed down from age to age, and we have got it, no matter whether it is correct or not, and whether the Lord found the earth empty and void, whether he made it out of nothing or out of the rude elements; or whether he made it in six days or in as many millions of years, is and will remain a matter of speculation in the minds of men unless he give revelation on the subject.[50]

In the twentieth century, James E. Talmage, mentioned above in the 1931 dispute over evolution, offered similar guidance: 

The opening chapters of Genesis, and scriptures related thereto, were never intended as a textbook of geology, archaeology, earth-science, or man-science. Holy Scripture will endure, while the conceptions of men change with new discoveries. We do not show reverence for the scriptures when we mis apply them through faulty interpretation.[51]

A second arena of contrast between creationism (YEC or IDC) and LDS theology regards God and natural law. Recall, for instance, the IDC notion of an "omnipotent" and "inscrutable" Designer. In contrast, Joseph Smith taught that God works in accordance with natural laws, rather than by transcending natural laws: "True science is a discovery of the secret, immutable and eternal laws, by which the universe is governed."[52] He specifically disavowed the notion of creation ex nihilo (out of nothing).[53] These sentiments were amplified by Brigham Young, Brigham H. Roberts, and others.[54]

Such principles naturally lead to a philosophy that seeks harmony between science and religion. As Brigham Young wrote, "In these respects we differ from the Christian world, for our religion will not clash with or contradict the facts of science in any particular."[55] John A. Widtsoe also urged accommodation, not conflict, with scientific research: "Scientific truth cannot be theological lie. To the sane mind, theology and philosophy must harmonize. They have the common ground of truth on which to meet."[56]

A third area of contrast is the question of the age of the earth, and whether there was death before the Fall of Adam. While some authorities have advocated literalist views here, others have been more flexible. James E. Talmage acknowledged the fossil record of countless generations of plants and animals, which "lived and died, age after age, while the earth was yet unfit for human habitation."[57] Brigham H. Roberts wrote: 

[T]o limit and insist upon the whole of life and death to this side of Adam's advent to the earth, some six or eight thousand years ago, as proposed by some, is to fly in the face of the facts so indisputably brought to light by the researcher of science in modern times....To pay attention to and give reason- able credence to their research and findings is to link the church of God with the highest increase of human thought and effort. On that side lies development, on the other lies contraction. It is on the former side that research work is going on and will continue to go on, future investigation and discoveries will continue on that side, nothing will retard them, and nothing will develop on the other side. One leads to narrow sectarianism, the other keeps the open spirit of a world movement with which our New Dispensation began. As between them which is to be our choice?"[58]

As noted above, Joseph Fielding Smith adopted a comparatively literal approach to the age of the earth, evolution and related issues, and these views were largely incorporated into McConkie's popular Mormon Doctrine (and were a source of the concern raised among top LDS authorities when this book was first published).[59] Yet it is clear from several studies of the church's posture toward science through the years that the Smith-McConkie approach is somewhat of an anomaly. A number of the early LDS leaders, as well as several of the present-day authorities, have recognized the futility of battling the scientific world and have favored a more progressive approach to these questions.[60]

For example, Elder Russell M. Nelson, in the April 2000 general conference, advocated a flexible interpretation of the seven days of creation: "Whether termed a day, a time, or an age, each phase was a period between two identifiable events—a division of eternity."[61] Further, the First Presidency now sends, to those who inquire about evolution, a short statement concluding with the summary quote from its 1931 letter (mentioned above): "Leave geology, biology, archaeology and anthropology, no one of which has to do with the salvation of the souls of mankind, to scientific research, while we magnify our calling in the realm of the Church." The text of this statement follows the article "Evolution" in the Encyclopedia of Mormonism, which was prepared with specific direction from top church leaders.[62] Along this line, current LDS church President Gordon B. Hinckley recently stated that the church requires only belief "that Adam was the first man of what we would call the human race." Recalling his own study of anthropology and geology, Hinckley said, "Studied all about it. Didn't worry me then. Doesn't worry me now."[63]

One final area of contrast between creationism and LDS theology regards the creationist notion that the earth and the universe may have an "appearance of age," and life on earth may suggest an evolutionary process, but this is because an omnipotent Creator created them that way, as part of an inscrutable plan.[64] Despite valiant efforts by creationists to rationalize this doctrine, it remains an exceedingly distasteful notion. Needless to say, this notion is utterly at odds with the LDS concept of a rational, comprehensible God, one who declared, "The Glory of God is intelligence; in other words light and truth."[65] Latter-day Saints are hardly alone in rejecting this notion. Catholic biologist Kenneth Miller writes, "In order to defend God against the challenge [creationists] see from evolution, they have to make him into a schemer, a trickster, even a charlatan. Their version of God is one who intentionally plants misleading clues beneath our feet and in the heavens themselves. . . .To embrace that God, we must reject science and worship deception itself."[66]

LDS scientists on the faculty at Brigham Young University universally reject (as far as I am aware) the young-earth creationist worldview. Many are sympathetic to a more general creationist philosophy, but only to the extent that such a philosophy is consistent with well-established principles of physical and biological science. University administration officials and others have attempted from time to time to impose creationist biology at the school, but these efforts have been scuttled.[67] Along this line, in 1992 the BYU Board of Trustees approved a packet of information regarding evolution to be provided for interested students at the university. It includes a few statements by first presidencies of the church and conveys a generally balanced, open-minded stance on the issue.[68]

I should add that recently some excellent books have been published by LDS scientists on these topics. Sterling B. Talmage's book, Can Science Be Faith-Promoting?, and the Stephens-Meldrum book, Evolution and Mormonism: A Quest for Understanding, are particularly recommended.[69]

Creationism and Modern Christian Thought

It should be noted that the creationist movement is endorsed by only a relatively small sector of the Christian community. Most mainline Protestant denominations made peace with evolution and other areas of modern science many years ago. In 1996 Pope John Paul II declared that "fresh knowledge leads to the recognition of the theory of evolution as more than just a hypothesis."[70] Along this line, a conference was recently held in Berkeley, California, entitled "Science and the Spiritual Quest." Numerous leading scientists, mostly with Catholic or mainline Protestant affiliations, participated in the meeting. Many expressed deep awe and wonder at the majesty of the universe, which is now known to be much vaster and more exotic than ever before imagined, and the beauty and elegance of the natural laws that govern it. Several of these scientists mentioned interesting new avenues where religion and modern science can accommodate and even reinforce each other.[71]

In tandem with these developments, numerous books have recently appeared which intelligently and sensitively explore these issues.[72] Physicist Paul Davies describes some remarkable features of our universe, such as its finely tuned physical parameters, and describes the wonder of advanced life on earth, which may be unique in a fairly large region surrounding the solar system.[73] Biologist Kenneth Miller asserts that one can be a serious scientist and a Christian believer, not because evolution is wrong, but because modern science (notably quantum mechanics and chaos theory) has destroyed the traditional notion of a deterministic, clockwork universe, thus allowing the hand of God in the ongoing process of creation.[74] Protestant theologian John Haught points out that in demanding a literal reading of Genesis, and in laying the truth of the Christian religion on the question of whether the Genesis text is scientifically correct, creationists are in effect ratifying the very philosophy (scientific materialism) that they most detest.[75] Haught also observes, 

If God were a magician or a dictator, then we might expect the universe to be finished all at once and remain eternally unchanged. If God insisted on being in total control of things, we might not expect the weird organisms of the Cambrian explosion, the later dinosaurs and reptiles, or the many other wild creatures that seem so exotic to us. We would want our divine magician to build the world along the lines of a narrowly human sense of clean perfection. 

But what a pallid and impoverished world that would be. It would lack all the drama, diversity, adventure, and intense beauty that evolution has in fact produced. A world of human design might have a listless harmony to it, and it might be a world devoid of pain and struggle, but it would have none of the novelty, contrast, danger, upheaval, and grandeur that evolution has brought about over billions of years. 

Fortunately, the God of our religion is not a magician but a creator. And we think this God is much more interested in promoting freedom and the adventure of evolution than in preserving the status quo.[76]

It is significant that none of these books are written by creationists of either the YEC school or the IDC school. Instead, they are written by reputable scientists and theologians, mostly with Catholic or mainline Protestant affiliations, who seek an intellectually honest harmony between modern science and religion. 

Conclusion

In summary, "scientific creationism" (as defined in the introduction) is not legitimate peer-reviewed science. It does not deserve to be presented on a par with conventional science in public schools. Instead, creationism is thinly disguised Biblical literalism.[77] And the new creation ism is, for the most part, merely the old creationism in "designer clothes."[78]

From a theological perspective, creationism leads to the distasteful notion of God as a great Deceiver, who has planted evidence throughout the earth and the universe to mislead diligent seekers of truth. Further, either form of creationism contrasts sharply with fundamental LDS beliefs, which teach of harmony between science and religion, and which describe a rational, comprehensible God, who works within, rather than beyond the realm of natural law. 

Creationist arguments in many cases represent new instances of the "God of the gaps" approach to theology—the philosophy that God can be found in the gaps of what currently remains unexplained in science. Those who have adopted this approach over the centuries have invariably been disappointed as scientific knowledge fills more of the remaining gaps. Many religious believers have also found that seeking "proofs" for the existence of God (scientific or otherwise) is an ineffective and often counter-productive route to faith. Jesus of Nazareth frequently commented on the dangers of seeking "signs" of this sort.[79]

Creationists create a false dichotomy: One must either accept their particular form of creationism or else reject faith in God. Yet many lead ing scientists with religious convictions, both LDS and non-LDS, have accommodated the findings of modern science without abandoning their basic religious beliefs. There is ample room within the scope of modern scientific knowledge for believing in an intelligent God who governs the marvelous ongoing process of creation. 

---

[1] William J. Over ton, "McLean vs. Arkansas Board of Education," court decision, 529 Federal Supplement 1255 (Eastern District of Arkansas 1982), available at http://cnsweb.bu.edu/pub/dorman/McLean_vs_Arkansas.html. See also Niles Eldredge, The Triumph of Evolution. . .and the Failure of Creationism (N.Y.: W. H. Freeman, 2000), 93-94.

[2] Jeffrey L. Sheler and Joannie M. Schroff, "The Creation," U.S. News & World Report, Dec. 23,1991, p. 59, available at http://www.usnews.com/usnews/news/create.htm. 

[3] James Glanz, "Evolutionists Battle New Theory of Creation," New York Times, April 8, 2001, p.l, available at http://www.nytimes.com/2001/04/08/science/08DESI.html. Some of this information is from Eugenie Scott, director of the National Center for Science Education (personal communication, 2001).

[4] Survey of biology students at BYU, conducted by Prof. William Bradshaw of BYU, 2001. 

[5] Joseph Fielding McConkie, Answers: Straightforward Answers to Tough Gospel Questions, (Salt Lake City: Deseret Book, 1998), 155-165.

[6] Ellen G. White, Spiritual Gifts: Important Facts of Faith, in Connection with the History of Holy Men of Old (Battle Creek, Mich.: Seventh-day Adventist Publishing Association, Battle Creek, 1864), 90-91; cited in Ronald L. Numbers, The Creationists (Berkeley, Calif.: University of California Press, 1993), 74. 

[7] Numbers, The Creationists, 76-77. 

[8] George McCready Price, The New Geology (Mountain View, Calif.: Pacific Press, 1923).

[9] John C. Whitcomb, Jr., and Henry M. Morris, The Genesis Flood: The Biblical Record and Its Scientific Implications (Philadelphia: Presbyterian and Reformed Publishing Co., 1961, reprinted 1998), xx, 118,120,174, 223,232-33, 238,273-75, 344-45,473. 

[10] Henry M. Morris, Scientific Creationism (El Cajon, Calif.: Creation-Life Publishers, 1974; 2d ed., 1985; reprint, 2000), 38-46,151-53. 

[11] Duane T. Gish, Evolution: The Fossils Say No! (El Cajon, Calif.: Creation-Life Publishers, 1973).

[12] Sterling B. Talmage, Can Science Be Faith Promoting? (Salt Lake City: Blue Ribbon Books, 2001), 190-95. 

[13] Jeffrey E. Keller, "Discussion Continued: The Sequel to the Roberts /Smith/Talmage Affair," Dialogue 15 (Spring 1982): 79-94. 

[14] Talmage, Can Science Be Faith Promoting?, 181-89. 

[15] Richard Sherlock, "We Can See No Advantage to a Continuation of the Discussion: The Roberts/Smith/Talmage Affair," Dialogue 13 (Fall 1980), 63-78.

[16] Joseph Fielding Smith, Man: His Origin and Destiny (Salt Lake City: Deseret Book, 1954).

[17] Talmage, Can Science Be Faith Promoting?, xlii; see also Sterling M. McMurrin and L. Jackson Newell, Matters of Conscience (Salt Lake City: Signature Books, 1996), 198.

[18] Bruce R. McConkie, Mormon Doctrine, 2d ed. (Salt Lake City: Bookcraft, 1966).

[19] Melvin A. Cook, Prehistory and Earth Models (London: Max Parrish, 1966); Melvin A. Cook and M. Garfield Cook, Science and Mormonism (Salt Lake City: Deseret News Press, 1967).

[20] Robert T. Pennock, Tower of Babel: The Evidence against the New Creationism (Boston: MIT Press, 1999), 30. 

[21] Phillip E. Johnson, "The Church of Darwin," Wall Street Journal, Aug. 16, 1999, available at http://www.arn.org/docs/johnson/chofdarwin.htm. 

[22] Phillip E. Johnson, Darwin on Trial (Washington: Regnery Gateway, 1991), 75.

[23] Michael J. Behe, Darwin's Black Box: The Biochemical Challenge to Evolution (N.Y.: Free Press, 1996), 39. 

[24] David Foster, The Philosophical Scientists, (NY: Barnes & Noble Books, 1993); see also Fred Hereen, Show Me God: What the Message from Space is Telling Us about God (Wheeling, 111.: Searchlight Publications, 1995), 94.

[25] William A. Dembski, "What Every Theologian Should Know about Creation, Evolution and Design," Center for Interdisciplinary Studies Transactions 3, no. 2 (1995): 15-21, available at http://www.origins.org/offices/dembski/docs/bd-theologn.html. See also Pennock, The Tower of Babel, 31. 

[26] Phillip E. Johnson, Defeating Darwinism (Downers Grove, 111.: InterVarsity Press, 1997), 92. See also Pennock, The Tower of Babel, 41. 

[27] Pennock, The Tower of Babel, 5. 

[28] Kenneth R. Miller, Finding Darwin's God: A Scientist's Search for Common Ground Between God and Evolution (N.Y.: Cliff Street Books, 1999), 76. 

[29] Eldredge, The Triumph of Evolution, 103-109; Miller, Finding Darwin's God, 63-80; Chris Stassen, "The Age of the Earth," 1997, available at http://www.talkorigins.org/faqs/faq-age-of-earth.html.

[30] Fred Hoyle and Chandra Wickramasinghe, Evolution from Space (London: J. M. Dent and Sons, 1981), 17. 

[31] Paul Davies, The Fifth Miracle: The Search for the Origin and Meaning of Life (N.Y.: Simon and Schuster, 1999). 

[32] Eldredge, The Triumph of Evolution; Miller, Finding Darwin's God; and Pennock, The Tower of Babel.

[33] Hans Peterson, "Cosmic Spherules and Meteoritic Dust," Scientific American 202 (Feb. 1960): 132. 

[34] Pennock, The Tower of Babel, 222. 

[35] Morris, Scientific Creationism, 151-53. 

[36] Howard J. Van Till, Davis A. Young, and Clarence Menninga, Science Held Hostage: What's Wrong with Creation Science AND Evolutionism (Downers Grove, 111.: InterVarsity Press, 1988), 82. See also Pennock, The Tower of Babel, 223. 

[37] Ronnie J. Hastings, "The Rise and Fall of the Paluxy Mantracks," Perspectives on Science and Christian Faith 40, no. 3 (1988): 144-55. 

[38] Whitcomb and Morris, The Genesis Flood, 174; Morris, Scientific Creationism, 122; El dredge, The Triumph of Evolution, 129; Pennock, The Tower of Babel, 220.

[39] Morris, Scientific Creationism, 38-46; Pennock, The Tower of Babel, 47. 

[40] Eldredge, The Triumph of Evolution, 96-97; Pennock, The Tower of Babel, 78-82; Frank Steiger, "The Second Law of Thermodynamics, Evolution, and Probability," 1997, available at http://www.talkorigins.org/faqs/thermo/probability.html. 

[41] Eldredge, The Triumph of Evolution, 120-34; Miller, Finding Darwin's God, 81-128, 264-65; John N. Wilford, "Feathered Dinosaur Fossils Are Unearthed in China," New York Times, April 26, 2001, available at http://www.nytimes.eom/2001/04/26/.science/26DINO.html. For a listing of many known transitional fossils, see Kathleen Hunt, "Transitional Vertebrate Fossils FAQ," 1997, available at http://www.talkorigins.org/faqs/faq-transitional.html. 

[42] Eldredge, The Triumph of Evolution, 110-13.

[43] Miller, Finding Darwin's God, 50-53. For some recently reported speciations, see Darren E. Irwin, Staffan Bensch, and Trevor D. Price, "Speciation in a Ring," Nature 409 (Jan. 18,2001): 333-37; David B. Wake, "Speciation in the Round," Nature 409 (Jan. 18,2001): 299-300; Joseph Boxhorn, "Observed Instances of Speciation," 1995, available at http://www.talkorigins.org/faqs/faq-speciation.html. 

[44] H. Allen Orr, "Darwin vs. Intelligent Design (Again)," Boston Review 21, no. 6 (1997), available at http://bostonreview.mit.edu/br21.6/orr.html. See also Pennock, Tower of Babel, 270. 

[45] Miller, Finding Darwin's God, 129-64. 

[46] Foster, The Philosophical Scientists; Hereen, Show Me God, 94; Hoyle and Wickramasinghe, Evolution from Space, 19; Pennock, The Tower of Babel, 231; David H. Bailey, "Evolution and Probability," Report of the National Center for Science Education 20, no. 4 (2001), available from http://www.dhbailey.com.

[47] W. A. Bentley and W. J. Humphreys, Snow Crystals (N.Y.: Dover Publications, 1962).

[48] Pennock, The Tower of Babel, 185-206.

[49] Joseph Fielding Smith, Doctrines of Salvation (Salt Lake City: Bookcraft, 1956), 3:188-90. 

[50] Journal of Discourses (London: Latter-day Saints Book Depot, 1873) 15:127.

[51] James E. Talmage, "The Earth and Man," Tabernacle address, Aug. 9, 1931, published in pamphlet form by LDS church. 

[52] Times and Seasons 4:46. 

[53] D&C 93:33. 

[54] Journal of Discourses (London: Latter-day Saints Book Depot, 1872) 14:116; Brigham H. Roberts, The Mormon Doctrine of Deity (1903; reprint, Bountiful, Utah: Horizon Publishers, 1982), 95-114.

[55] Journal of Discourses 15:127. 

[56] John A. Widtsoe, Joseph Smith as Scientist (Salt Lake City: Bookcraft, 1908; reprint, 1964), 156. 

[57] Talmage, "The Earth and Man," 1931. 

[58] Brigham H. Roberts, The Truth, the Way, the Life: An Elementary Treatise on Theology, ed. Stan Larson (1931; reprint, Salt Lake City: Smith Research Associates, 1994; also Provo, Utah: BYU Studies, 1994), 364. 

[59] David O. McKay diary, entries dated Jan. 7-8, 14, 27, 28, I960, transcript in author's possession.

[60] Duane Jeffery, "Seers, Savants and Evolution: The Uncomfortable Interface," Dialogue 8 (Autumn 1974): 41-75; Erich R. Paul, Science, Religion, and Mormon Cosmology (Chicago: University of Illinois Press, 1992). 

[61] Russell M. Nelson, "The Creation," Conference Report, April 2000. 

[62] Daniel H. Ludlow, ed., The Encyclopedia of Mormonism (N.Y.: Macmillan, 1992), 2:478.

[63] Larry A. Witham, Where Darwin Meets the Bible, (NY: Oxford University Press, 2002): 176-77. 

[64] Whitcomb and Morris, The Genesis Flood, 233-39; Morris, Scientific Creationism, 209-10.

[65] D&C 93:36. 

[66] Miller, Finding Darwin's God, 80.

[67] Gary J. Bergera and Ronald Priddis, Brigham Young University: A House of Faith (Salt Lake City: Signature Books, 1985), 131-71. 

[68] "Evolution and the Origin of Man," packet of information approved by BYU Board of Trustees, June 1992, compiled by William Evenson, available at http://www.frii.com/~allsop/eyring-l/faq/evolution/trusteesl992.html.

[69] Talmage, Can Science Be faith-Promoting?; Trent D. Stephens and D. Jeffrey Mel drum, Evolution and Mormonism: A Quest for Understanding (Salt Lake City: Signature Books, 2001). 

[70] Pennock, The Tower of Babel, 39. 

[71] Sharon Begley and Marian Westley, "Science Finds God," Newsweek, July 20, 1998, 46, available at http://www.washingtonpost.com/wp-srv/newsweek/science_of_god/scienceofgod.htm.

[72] Ian G. Barbour, Religion and Science: Historical and Contemporary Issues (San Francisco: HarperSanFrancisco, 1997); Paul Davies, The Accidental Universe (London: Cambridge University Press, 1982); Davies, The Fifth Miracle; Stephen Jay Gould, Rocks of Ages: Science and Religion in the Fullness of Life (N.Y.: Ballantine Publishing Group, 1999); John F. Haught, God after Darwin: A Theology of Evolution (Boulder, Co.: Westview Press, 2000); John F. Haught, Science and Religion: From Conflict to Conversation (N.Y.: Paulist Press, 1995); Miller, Finding Darwin's God; John Polkinghorne, Belief in God in an Age of Science (New Haven: Yale University Press, 1998); Michael Ruse, Can a Darwinian Be a Christian? The Relationship between Science and Religion (London: Cambridge University Press, 2000).

[73] Davies, The Accidental Universe; Davies, The Fifth Miracle. 

[74] Miller, Finding Darwin's God, 17. 

[75] Haught, Science and Religion, 52; Haught, God after Darwin, 31. 

[76] Haught, Science and Religion, 62.

[77] Overton, "McLean vs. Arkansas." 

[78] Pennock, Tower of Babel, 275. 

[79] Matt. 12:39,16:4; Mark 8:12; Luke 11:29.

[post_title] => Mormonism and the New Creationism [post_excerpt] => Dialogue 34.4 (Winter 2002): 39–59
This paper will deal with a more specific form of creationism, which is often termed "creation science" or "scientific creationism" (these terms will be used synonymously). [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => mormonism-and-the-new-creationism [to_ping] => [pinged] => [post_modified] => 2024-01-28 17:30:48 [post_modified_gmt] => 2024-01-28 17:30:48 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10737 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10739 [post_author] => 2159 [post_date] => 2018-03-27 21:09:52 [post_date_gmt] => 2018-03-27 21:09:52 [post_content] =>

Introduction

The world is rapidly changing as new technologies change the way we think, act, and live. This is particularly true with the many changes biology has wrought in our lives over the last few years. Nearly every day new discoveries are made which advance scientific knowledge and enable us to lead longer, healthier lives. This new scientific information is disseminated to the public daily via television, radio, newspaper, and the internet. New words such as cloning, genomics, anthrax, and genetically modified food, are rapidly entering the layperson's vocabulary. Just as the Industrial Revolution changed the world into a mobile, manufacturing, technology-based economy, the "Biological Revolution" will have similarly unimaginable effects upon our world. These include the curing of some of the most dreaded diseases, such as cancer, and the treatment of age-related illnesses to enable longer, more productive lives to be led. Unfortunately, these same techniques can be used for evil, as recently witnessed by the anthrax bioterrorism attacks. 

How will these current and future discoveries within the realm of bi ology affect Mormonism? This essay is an attempt to understand new scientific breakthroughs within the context of the gospel by focusing on molecular biology and the Human Genome Project, since these two enterprises have been important catalysts for the Biological Revolution. First, a brief introduction to the church's historical attitude toward science will be presented to outline the context of the church's relationship with science. Then, a primer on molecular biology and the Human Genome Project will be presented. In addition, the importance of the Human Genome Project to society will be addressed, and some of the ethical issues associated with the genome data will be analyzed. Finally, these ethical issues will be applied to some doctrinal ideas to show how the Biological Revolution could complicate traditional Mormon doctrines. 

The Battle Between Mormonism and Science

Since the advent of Darwinism in the late nineteenth century, Mormonism and biology have found themselves in a constant battle, particularly over evolution. The church did not have a particularly strong, united anti-science stance in the late nineteenth and early twentieth century when noted Mormon scientists, such as John Widstoe, James Talmage, and B. H. Roberts, were found in the leading councils of the church. Since the deaths of these men in the 1930s, however, the battle between Mormonism and science has been especially strong. From the 1930s until the mid 1980s, Joseph Fielding Smith and Bruce R. McConkie have consistently discussed the evils of evolution and—by extension—science and scientists.[1] In their speeches and through their books,[2] they have clearly stated their positions, implying that these are also the official church position. However, the church says it takes no official position or stand on the issue of evolution except that Adam and Eve were the first humans.[3]

The views of Smith and McConkie have created a conundrum for members of the church. While evolution and the science associated with it have been seen as an inherent evil, the miracles of modern medicine have been seen as blessings from God. For instance, Elder McConkie states, "the Lord...intends that men should use the agency and intelligence He has given them in both preventing and curing sickness."[4] Furthermore, McConkie states, "The promised latter-day increase of knowledge and learning is evidenced by the many inventions....We have already seen the disco very... of medicinal advances, surgical achievements and wonder drugs."[5] However, McConkie harshly criticizes evolution as completely incompatible with the gospel. As a summation to his article on evolution, he states, "There is no harmony between the truths of revealed religion and the theories of organic evolution."[6] Hence, members of the church often have believed that science is inherently evil, unless it is for the direct medicinal benefit of humankind. The problem with this argument is that the same science and often the same scientists make discoveries in both evolutionary biology and modern medicine. These two fields of science are not mutually exclusive. For example, powerful techniques in molecular biology enable scientists to more rapidly discover new drugs, while the same techniques are also used to generate evidence in support of evolutionary processes. This dichotomy will become more apparent in the future as more scientific discoveries are made which treat disease and at the same time strengthen the case for evolution.[7]

What Is Molecular Biology?

Molecular biology studies the basic molecules and processes which combine to create a living organism. This field of study has been the impetus for many of the scientific advancements in the last twenty years in many fields of science, including modern medicine and evolutionary biology. A short lesson on some scientific terms will enable a more fruitful discussion. DNA—an acronym for deoxyribonucleic acid—is composed of a long chain of nucleosides. Nucleosides are created by joining a nucleotide (purine or a pyramidine ring) and a deoxyribose molecule (sugar molecule). The purine/pyramidine bases can be one of four molecules: Cytosine (C), Thymine (T), Guanine (G), or Adenine (A). C-G and A-T can form a molecular interaction or bond with one another, which results in the joining of two parallel DNA strands. In this way, a chain of nucleotides can form a simple alphabet comprised of the four letters AGCT. An organized chain of these bases composes a single gene. The average gene is composed of three thousand nucleotide bases.[8] For example, AAGGTCGATTCCAAGCTGGATGCAGAATTC could be the alphabet for a portion of a gene. Every three bases—a "codon"—contain the code for one amino acid. (Three unique codons actually code for a stop, which means that the full length of the protein has already been synthesized.) For example, ATG codes for the amino acid Methionine. Chains of amino acids form proteins, while a single protein is usually encoded by a single gene. For example, insulin is a protein encoded by the insulin gene. All of the genes and non-coding DNA (i.e., DNA containing regulatory elements for genes and other functions not discussed here) found in a single organism make up that organism's genome. Gene-encoding DNA is first turned into ribonucleic acid, or RNA, as an intermediate step to making a protein. This ensures that only gene-containing DNA is made into protein, as the protein-creating machinery only recognizes RNA. The movement of information from DNA to RNA to protein is called the "Central Dogma." 

Molecular biology, as a field of study, began in the 1970s with the discovery of several new technologies. First, it was discovered that RNA could be turned into DNA using a special enzyme discovered in retroviruses (for example, HIV is a type of retrovirus). This enzyme allowed researchers to convert RNA into DNA. RNA is very unstable, and little could be done to identify which particular gene a strand of RNA encoded. Second, the ability to transfer pieces of DNA from one DNA molecule to another using restriction endonucleases (enzymes which cut DNA in specific sites) enabled researchers to chop up long stretches of DNA into smaller pieces and put these smaller strands together again into a desired order. Third, circular DNA molecules (plasmids) could be grown in bacteria to amplify billions of copies of that particular piece of DNA. By this method, individual genes isolated from an organism's genome (through the conversion of RNA into DNA) could be inserted into a plasmid. The bacteria could synthesize many copies of that plasmid, and then the plasmid DNA could be isolated in large, relatively pure quantities. This amplification of DNA can also be performed in a test tube using a technique called the polymerase chain reaction (PCR). Fourth, the ability to sequence DNA, or identify the individual bases (i.e., read the alphabet), allowed researchers to identify which regions of DNA contained genes and which regions contained other DNA elements. These technologies have been combined to create a very powerful method for identifying the genes within an organism. In addition, these techniques allow scientists to understand the roles of the proteins encoded by these genes in creating an organism and in causing disease, while also providing insights into the evolutionary relationships between different species. 

What Is the Genome Project?

The Human Genome Project has been a distinct catalyst for many recent scientific breakthroughs. It was begun in 1990 with the goal of sequencing all three billion bases (A,C,G,T alphabet) of the human genome by 2005. The project was under the direction of the National Institutes of Health and a consortium of university labs throughout the world. Due to improvements in technology, the sequencing was finished during the summer of 2000, five years early, and below budget (not many government programs accomplish that!). A publicly held company, Celera Gemonics, also sequenced the entire human genome and finished at the same time as the public consortia. (Celera actually began sequencing the genome in the late 1990s, but quickly caught up with the government consortia.) The three billion sequenced bases (3164.7 million) are found on twenty-three sets of chromosomes which exist in nearly every one of the human body's 100 trillion (100,000,000,000,000) cells. The data from the human genome sequencing was published in the February 15, 2001 issue of Nature and in the February 16, 2001 issue of Science.[9]

With the sequencing finished, the task of assembling and analyzing the tremendous amount of generated data has begun. The first step was to identify the number of unique genes existing in the human genome. Using powerful computer technology, scientists have come to believe that the actual number of genes will be around 35,000-40,000, barely double that of a primitive roundworm (Caenorhabditis elegans).[10] Each gene must be studied individually to learn its particular role in the development, maintenance, and disease processes of our bodies. This is done by first discovering where a particular gene is expressed, when it is expressed, and finally, how its expression is controlled in each region of the body. In addition, each protein produced by these genes (genes can actually encode for a single or many different proteins) must then be studied to learn which other proteins it interacts with and how this interaction is controlled. By creating this large web of interactions and control mechanisms, we will finally understand physiological processes such as embryology, growth, puberty, aging, and disease. 

Why is the Human Genome Project Important?

In the past few years, we have just begun to understand the importance of the Human Genome Project. Since the project was launched, many thousands of genes have been identified as the sequencing has progressed. In addition, hundreds of mutations in specific genes have been found which can cause a particular disease. Muscular dystrophy, cystic fibrosis, Huntington's disease, and breast cancer are some examples for which disease-causing mutations in a particular gene are now known. 

Pharmaceutical and biotechnology companies are focusing upon those genes containing disease-causing mutations. Once researchers have identified such genes, drug design can occur. Drug design involves creating drugs to disable the mutant protein, bypass the mutant protein, or "fix" the mutant protein. This process is known as "rational drug design." It is hoped that this method of drug development will cut down the tremendous costs (up to $500 million per drug) and time (between five and ten years) currently associated with bringing a drug to market. This would potentially lower the cost of drugs for patients. The money could also be used to develop additional drugs to cure and treat many diseases, including various types of cancer, age-related illnesses, and other genetic diseases. 

In addition, now that the entire complement of genes within the human body is known, scientists can be more precise at analyzing the toxicity of newly designed drugs on the entire genome of an individual, and by inference the individual's body, without actually affecting a patient until the drug is known to be both safe and effective. This would be important, as many thousands of lives are lost each year due to unforeseen drug interactions and toxicity. To analyze drug toxicity, a copy of each gene found within a person's genome is attached to a glass slide. Cells isolated from the person's body can then be tested with potential drugs by first isolating their RNA, converting it to DNA, and testing it with the drug. Some genes will be turned on and others turned off by the drug. By comparing the expression profile of the treated cells with the profile of untreated cells, scientists can identify toxicity and selectivity of drug candidates. The technique also creates a relatively quick, simple, and cheap method for genetic testing. In the future, many tests could be performed using this technique to rapidly assess which drugs would most benefit a particular patient's condition given their unique response profile to a set of drugs. 

In addition to the potential "miracle drugs" which may be developed based upon information gleaned from the Human Genome Project, information will also be obtained regarding what makes the human species unique. Some of the questions that could be answered include: Which genes make us different from a mouse or a monkey? Do humans have the same genes as apes? Are there distinct genes that are unique to humans? Are there genes that enable us to have consciousness or emotions? If we have all the genetic information of a human, could a synthetic human then be created? Are there genes that help determine spirituality, kindness, and love? What are the actual genetic differences between men and women? How are these genetic differences manifested in behavioral and physical characteristics? The answers to these questions and many more will come as the data from the Human Genome Project is further studied. 

The Human Genome Project and Ethics

The promise of new drugs to cure and/or treat disease may sound wonderful to Latter-day Saints and the world at large, but what are some of the other implications of the Human Genome Project? Should Latter-day Saints be concerned about these future issues? I would like to highlight a couple which will be a) relevant to members of the church, and b) particularly difficult for the church to formulate a doctrinal response to. This list is not mutually exclusive or collectively exhaustive; rather, it is an attempt to stimulate a thoughtful reflection in the reader's mind. 

First, the knowledge gained from the Human Genome Project will allow researchers to know which genetic type ("genotype") leads to certain physical traits ("phenotype"). For instance, the genotypes which lead to above average intelligence, "perfect" physique, eye color, hair color, skin color, etc. could be identified. With the technical ability to perform in vitro fertilization, one could presumably "test" an egg and sperm, or the newly fertilized embryo, to choose traits desired by parents for their offspring. This could lead to a race of people with "perfect" genetic traits. Could this lead to two populations, one that selects for offspring, and one that fertilizes via natural means? (A similar story line was found in the recent Hollywood movie, Gattaca.) While such a scenario may seem unfeasible, sex selection does currently occur, and selection for embryos devoid of certain disease genes also occurs. Therefore, the next step would be selection for desirable traits. Clearly, the church would be against such selection for vain purposes, but what if we could select for better leaders, better missionaries, or other desirable traits? Would it be okay to select traits such as compassion, peacemaking, etc.? The church is currently not adamantly against in vitro fertilization when the child will be the biological offspring of its parents (and even when it is not, in vitro fertilization is not considered a sin). Would the official church stance change in the face of such genetic selection? Would the church strike a more conservative ground, as it has with its stance against abortion? (Members are currently allowed abortions in the case of incest, rape, severe deformities which would prevent life after birth, and in cases where the mother's health is in jeopardy.) 

Second, genetic testing of individuals for disease genes is already occurring for a select number of diseases. The number of diseases tested and the number of people tested will increase as less expensive, more efficient techniques are developed. Such testing allows individuals to know if they are prone to a certain disease, but what if there is no treatment for the disease? For example, a person could be tested for Alzheimer's disease and learn that she had a fifty percent chance of developing the disease in the next ten years. Unfortunately there is nothing that can be done to prevent her from developing the disease. Is it ethical to tell someone he or she is a "walking time bomb" for a disease? What effects could these "time bombs" have upon society as a whole? 

Third, genetic discrimination toward those who carry disease genes or other "undesirable" genes could occur. This discrimination could take the form of insurance companies refusing to issue life or health insurance to those with such genes. Furthermore, employers could terminate employees with certain genotypes to keep healthcare costs low. Laws could prevent much discrimination, but experience shows that discrimination will nonetheless occur. If widespread genetic selection occurs, could those who choose not to genetically select be discriminated against by employers, schools, insurance companies, etc.? Again, the church would likely be against discrimination in any form, but how would it respond to genetic testing? What if genetic testing were mandated by employers? What about laws that impair the rights of those who refuse to be genetically tested? Will the church still uphold the law? 

Fourth, as genes are identified with specific functions in the body, it is entirely probable that some will be found which are linked to homo sexuality, alcoholism, and violent behavior. Thus, people who exhibit such behavior could be genetically prone to do so. While being predisposed to a behavior does not preclude one's free agency, would more compassion and perhaps leniency be given to those "afflicted" with such genes? Could homosexuals be "cured" of such behavior, if a genetic mutation is the root cause? Would homosexuality be treated differently within the church or, at least, be more tolerated? Would it be considered a "flaw" to carry these types of genes? Will drugs to "cure" or treat these behaviors be developed? What behaviors should be considered for future drug design? 

Fifth, genetic testing for deleterious genes will probably result in an increase in the abortion rate, as fetuses which carry deleterious genes im pairing normal life are aborted. This would mean that fewer people would have mental and physical disabilities such as Down's syndrome. It is entirely possible that these disabilities would then exist only in conservative religious groups opposing abortion and strongly discouraging or prohibiting members from participating in abortions. Two key problems occur in this scenario: 

First, how would the church interpret its current stance which allows abortion based upon "severe deformities, which prevent life after birth"? What is a "severe deformity"? What is considered "life" after birth? Is living in a vegetative state in an institution "life"? Could abortion be considered an option for some disabilities? If so, which ones? Is there a purpose for children with severe disabilities in families? (Church leaders would most likely say "yes.") Would the increase in abortion of these fetuses result in the loss of blessings for the parents? How would the Lord compensate for the loss of these "special" spirits? 

The second conflict concerns the larger societal and financial costs associated with treating disabled individuals who could have been aborted in the first place. Should society as a whole pay for the cost to treat such severely disabled persons? While it seems unfathomable to members of the church, the sad reality is that money may play a larger role in this than it should. Would parents who choose to have disabled children be forced to pay the costs for treating these children when their insurance or government programs declined to cover the costs? What if governments passed laws mandating abortion of fetuses carrying certain deleterious mutations? Would the Twelfth Article of Faith still be valid in these countries? 

Finally, it is only a matter of time before the cloning of a human being occurs. Many different species of mammals have already been cloned, including primates.[11] Therefore, it is probable that someone, perhaps not in the United States or Europe, will clone a human being in the near future. What is the nature of a cloned human's spirit? Did God account for the clone in the preexistence? Does the clone's spirit look identical to the donor's spirit? If so, did God "clone" these spirits to look identical to each other in every way? 

Effects upon the Church?

As can be seen from the above discussion, the Human Genome Project can lead to many wonderful advances for humankind, but it also raises some very complex ethical issues for humankind in general and Mormonism in particular. However, nothing has been written in church publications or said in general conferences about the Human Genome Project.[12] In fact, in recent years, very little has been said about science over the pulpit. The leadership of the church appears to have taken a bystander approach to science under the auspices of Presidents Benson, Hunter, and Hinckley. This approach has probably been due to the fact that many within the leading hierarchies of the church do not understand science and have little time to study it, as many other pressing needs of the church must be met. This has been a fair and appropriate response for the leaders of the church to take as the work of the gospel takes precedence over scientific or ethical issues. Yet, as can be seen from the discussion in this article, the ethical issues arising from the Human Genome Project are no longer potential scenarios, but very real situations that will occur and are now occurring. It is critical that leaders of the church become aware of these issues before they become acute, so that appropriate responses are considered. If church leaders are well pre pared for the ethical dilemmas imposed by the Biological Revolution, then a hastily developed, poorly considered response to such issues will be averted, and church members will be less bewildered and troubled. 

In this section, I have highlighted a couple of previously simple doctrinal issues which have been greatly complicated by the Human Genome Project. First, we now have the theoretical capability to create a human being, based upon the newly mapped blueprint of human DNA. We have the knowledge to synthetically create humankind, a power previously reserved for God! Furthermore, we may soon have the knowledge to create a "perfect" human who would not be susceptible to all the physical ailments we currently experience because of imperfect genes. Such individuals should live longer lives and could potentially live forever. (Perhaps, the resurrection is merely the cloning of someone who has already died, while fixing the imperfections within their DNA to render them immortal.) Are humans treading on ground reserved exclusively for God? Or has God given us this knowledge and capability so that the eventual resurrection will be easier to understand for those still on the earth? In fact, perhaps those on the earth during the Millennium could actually participate in the resurrection of their fellow people and animals. 

A second, very complex doctrinal issue involves the makeup of our spirits versus our physical selves. If our spirits resemble our physical selves, and the blueprint for our physical appearance is found within our DNA, then how does a premortal spirit resemble our physical self when our DNA constitution was not known until we were conceived? Two possible scenarios could explain this situation. 

First, it is possible that our premortal spirits did not have distinct physical characteristics, but acquired them once the physical makeup of the body was known. For example, a spirit could have a "general" human form without attaining its exact or final form until conception of its body. However, this argument does not fit well with the book of Ether in the Book of Mormon, when the brother of Jared saw Christ's physical presence thousands of years before Christ was born. 

The second possible scenario suggests that God knew our physical makeup before we were born, and hence, knew what our DNA genotype would be. This explains why our spirits would resemble our physical bodies. If this is the case, then the random distribution of genotypes during the reproductive processes is not random at all, but controlled by the Holy Ghost under God's direction. This also seems improbable, though not impossible. Perhaps the correct answer is a mixture of these two scenarios. God knows who our parents will be and creates a spirit that is a mixture of traits from the two parents. This spirit can then take on the "detailed" characteristics of its genotype after conception, including whatever flaws may exist within our DNA and, subsequently, our physical bodies. 

These two examples illustrate some of the complex doctrinal issues created by the completion of the Human Genome Project. Such issues will continuously be brought to our attention as our world becomes increasingly reliant upon new and ever-changing technological advances. It will be particularly interesting to watch the response of the church leadership and membership to these complex doctrinal issues. 

The Conundrum Revisited

There are two distinct areas with which the church must deal when facing the future of science: ethical problems and doctrinal issues. We may see the church take a very active part politically to ensure that its interests and the rights of its members are not impeded with regard to certain ethical issues. It is unlikely that the church will change its long-held dogmas concerning abortion, homosexuality or any other non-doctrinal issue. A coalition comprising the church and other conservative religious groups might well be formed to fight against any real or perceived attacks upon these traditional dogmas. It is also possible that new revelation will be received to address some of these ethical issues through doctrinal changes. 

The response of the church toward evidence which complicates or negates certain doctrines could take two directions. First, the church could dismiss such evidence as "of the Devil" and false. It could also re-state the current doctrine as the truth, even if this doctrine were complicated with new evidence. Finally, a new revelation could be given to clarify or restate such doctrine in light of new evidence. In actuality, a mixture of responses will probably occur, depending upon the nature of the doctrinal "attack" and the importance of the doctrine that is "attacked." One can envision many non-core doctrines being compromised without much communication from church leadership. However, if a core doctrine is compromised in any way, real or perceived, then one can expect a response from church leadership. 

Conclusion

The completion of the Human Genome Project is one of the greatest accomplishments humankind has ever achieved. Members of the church should embrace this accomplishment with all its associated fanfare. We should recognize that God has blessed us with the knowledge, talent, and ability to decode the entire human genome. This knowledge gives us insight into how the creation of humans was undertaken. In the future, more knowledge will be gained about what makes humans unique. We will know more about how we think, how we act, and the nature of human consciousness. Should any of these advances frighten Mormons? No. Should these advances be viewed as an attack upon our religion? No. The knowledge obtained is the truth, as we know it. We should therefore embrace it and find ways to learn more about our purpose here on Earth. We have been blessed with this wonderful knowledge about ourselves. What we do with it is up to us.

---

[1] Gene Sessions and Craig Oberg, The Search for Harmony: Essays on Science and Mormonism (Salt Lake City: Signature Books, 1993). 

[2] Joseph Fielding Smith, Man: His Origin and Destiny (Salt Lake City: Deseret Book, 1954); Bruce R. McConkie, Mormon Doctrine (Salt Lake City: Deseret Book, 1993).

[3] Trent D. Stephens, D. Jeffrey Meldrum with Forrest B. Peterson, Evolution and Mormonism: A Quest for Understanding (Salt Lake City: Signature Books, 2001).

[4] McConkie, Mormon Doctrine, 573. 

[5] Ibid., 72. 

[6] Ibid., 256.

[7] Stephens and Meldrum, Evolution and Mormonism. 

[8] U.S. DOE Human Genome Project. Human Genome News 11, no. 1-2 (November 2000).

[9] Entire issue, Science, 291, no. 5507 (16 February 2001), see especially, Svante Paabo, "The Human Genome and Our View of Ourselves," 1219-1220; Entire issue, Nature 409, no. 6822 (16 February 2001), see especially, David Baltimore, "Our Genome Unveiled," 814ff. 

[10] US DOE, Human Genome News 11:3.

[11] A. W. S. Chan, T. Dominko, C. M. Luetjens, E. Neuber, C. Martinovich, L. Hewit son, C. R. Simerly, and G. P. Schatten, "Clonal Propagation of Primate Offspring by Embryo Splitting," Science 287, no. 5451 (4 January 2000), 317-19. 

[12] Determined by searching the church magazine database found at www.lds.org.

[post_title] => The Human Genome Project, Modern Biology, and Mormonism: A Viable Marriage? [post_excerpt] => Dialogue 34.4 (Winter 2002): 61–71
THE WORLD IS RAPIDLY CHANGING as new technologies change the way we think, act, and live. This is particularly true with the many changes biol￾ogy has wrought in our lives over the last few years. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => the-human-genome-project-modern-biology-and-mormonism-a-viable-marriage [to_ping] => [pinged] => [post_modified] => 2024-01-11 01:28:54 [post_modified_gmt] => 2024-01-11 01:28:54 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10739 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 10754 [post_author] => 2307 [post_date] => 2018-03-27 21:28:29 [post_date_gmt] => 2018-03-27 21:28:29 [post_content] =>

I understand there may be some wards in the church where members are able to rationally discuss controversial issues in Sunday School without hurling accusatory labels (and odd pieces of rotten fruit) at each other. This seems unlikely to me, but my brother-in-law, Rick Walton, swears that his Provo ward never has doctrinal arguments, that all members agree with one other—and if not, they simply refrain from mentioning certain subjects. While Rick's observations may be a tad naive, or perhaps merely a symptom of encroaching Alzheimer's, I am nevertheless left with the impression that I am stuck in an unusually quarrelsome ward. 

From the moment we moved into the Ogden 40th Ward ten years ago, I found myself secretly at odds with certain members who seem to think that all Latter-day Saints are—or should be—ideological clones. In one Sunday School class, we were subjected to a member's musings about the "good old days" when white people weren't allowed to marry blacks in the temple. Several times we have been treated to diatribes against Democrats—specifically and generally—as if, naturally, all of us understood that only Republicans could be good people. Through it all, I held my tongue on the advice of my calm, rational, college professor husband who really detests conflict. 

But one issue finally turned me into what my teenagers describe as a "bitter old lunatic." That issue was evolution. 

It is true that every time the subject of evolution comes up at church, I come home ranting like a "lunatic." It's also true that I have been "bitter" from time to time. But "old"? Come on. I'm only forty-five. 

Sometimes, I seem to be the only person in the entire church who knows that it's okay to believe in evolution and still be a faithful, believing Mormon. I have heard unconfirmed rumors that there are others— perhaps even a few here in Ogden, Utah—who are aware of this fact, but so far not one has come forward in my presence. They must still be in The Evolution Closet, secret members of a secret cult with secret dreams, looking forward to the day when they will be able to expose their beliefs to the world without being publicly branded with a scarlet "L" for "Liberal." 

As for me, I received that brand long ago when the ward learned that my family had become vegetarians. (Well, in truth, I was the first family member who became a vegetarian, but since I am the only cook in the household, the entire Reynolds clan was forced to convert.) This was yet another cause for head-shaking. I was told—gravely—by several ward members that "Mormons don't have to be vegetarians." Thank you, ward members. I grew up and have been active in the church my whole life, not to mention going on a mission, graduating from four years of BYU religion classes, and reading all four standard works at least eight times through. And yet somehow I had strayed into vegetarianism. 

Thus, I suppose that my recent emergence from the Evolution Closet was simply further evidence of my straying. It was a spectacular emergence, if I do say so myself. After an unsuspecting sister mentioned a "stupid" acquaintance who believed in evolution, I actually shouted at the entire Relief Society. To the best of my memory, these were my remarks: "I'm tired of being told by church members that I'm evil or stupid if I believe in evolution! Just respect my opinions and I'll respect yours!" 

To fully understand this outburst, you have to know that a few months before, my 17-year-old daughter had been told by her seminary teacher that "people who believe in evolution are evil." Now, I'm pretty sure it isn't the intention of the church to have its seminary teachers calling their students' parents—or anyone, except perhaps serial killers or child molesters—"evil." In fact, it doesn't sound remotely Christian to me, even if you count fundamentalist scolds as "Christian," which I'm not at all sure you can do. But our poor daughter, whom we had tried to teach through the years that she could make up her own mind about evolution, came home doubting her own parents. This was enough to inspire a bitter lunatic. I wanted to march down to that seminary and give that teacher a chunk of my mind, as well as some official church sponsored written material, but my (conflict-avoiding) husband yet again advised me to "let it go." So I did. It may have been the very first time in our marriage that I actually followed his advice. 

You might think his advice was good and that peace is surely always the better option. But that single incident seems to have festered inside the dark corners of my head, opening up a wound which would not heal and, in fact, grew and grew until I burst out of The Closet in that Relief Society meeting, bellowing my perfidy to the world. So now everyone knows that I am an evolutionist—and hence also stupid and evil, but at least now I'm openly so.

As for my future plans, I am considering starting a support group for "Mormons Who Believe in Evolution." The scattered few of us need to get together and lean on each other. We could swap persecution stories and share interesting scientific details, such as the fact that a banana is only 15 percent genetically different from a human. (Obviously, some of us are more banana-like than others.) We could have a website and conduct periodic live-chat sessions. In other words, it's time to come out of The Closet. "United we'd stand," at least until the universe starts collapsing on itself. But that's another controversial issue. You'll have to get your own support group for that.

[post_title] => Coming Out of the Evolution Closet [post_excerpt] => Dialogue 34.4 (Winter 2002): 143–145
Sometimes, I seem to be the only person in the entire church who knows that it's okay to believe in evolution and still be a faithful, believ￾ing Mormon. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => coming-out-of-the-evolution-closet [to_ping] => [pinged] => [post_modified] => 2024-01-11 01:19:13 [post_modified_gmt] => 2024-01-11 01:19:13 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=10754 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 11454 [post_author] => 1931 [post_date] => 2018-04-06 03:37:32 [post_date_gmt] => 2018-04-06 03:37:32 [post_content] =>

In 1832, while Joseph Smith was organizing the Mormon church, Ralph Waldo Emerson wryly observed, "The Religion that is afraid of science dishonours God and commits suicide."[1] One hundred sixty-four years later, as the church faces a new century and a new millennium, issues in the arena of science and religion are still before us. 

Will the church be able to retain the essence of its theology in the face of challenges from science? Will the church's discourse on scientific topics be marked by fundamentalism, isolationism, or progressivism? Will the church be able to retain its large contingent of professional scientists? Will it be able to produce new scientists in fields germane to this discussion? Will Mormon youth be able to sort out conflicts between faith and science? What will be the likely outcome of the faith versus science issues currently being discussed in LDS literature? What entirely new issues will emerge? What is the likelihood that the church will be able to deal with these new issues? 

A Glance at the Past

Before answering these questions we first need to review briefly the history of scientific thought in the LDS movement. Additional information can be obtained in the helpful works by Duane Jeffery[2] and Erich Robert Paul.[3]

At a time when other Christian faiths were still smarting from the Copernican revolution, Joseph Smith's revelations included frequent references to God's vast creations—"worlds without number" (D&C 76:24, 88:37-39, 93:10; Moses 1:29-35; Abr. 3:9). In another departure from Chris tian orthodoxy, Joseph taught that God works in accordance with natural laws: "True science is a discovery of the secret, immutable and eternal laws, by which the universe is governed."[4] Joseph specifically denied creation ex nihilo, teaching instead that matter is eternal (D&C 93:33). 

Other early church leaders expressed similar views. Orson Pratt, who authored a number of scientific and mathematical works, advocated the Platonic view that scientific truths are known to God and that humans merely rediscover them as their knowledge progresses.[5] Orson's older brother Parley P. Pratt emphasized that LDS theology encompasses all of human knowledge, including "philosophy, astronomy, history, mathematics, geography, languages, the science of letters."[6] Brigham Young was also receptive to the pursuit of scientific knowledge, emphasizing its beauty, practical value, and divine origin. He was particularly open-minded about such issues as the age of the earth and the questionable reliability of the Bible as a scientific text.[7]

In his monumental opus The Truth, The Way, The Life,[8] B. H. Roberts attempted to harmonize modern secular and scientific knowledge with LDS theology. He included many details of the current understanding of astronomy and astrophysics, even Hubble's expanding universe and Einstein's relativity. He acknowledged the antiquity of the earth and the existence of pre-Adamic life, including beings resembling modern-day humans.[9] He repeatedly emphasized that both science and revelation are indispensable in the search for ultimate truth. For example, with regard to the Creation he taught, 

On the other hand, to limit and insist upon the whole of life and death to this side of Adam's advent to the earth, some six or eight thousand years ago, as proposed by some, is to fly in the face of the facts so indisputably brought to light by the researcher of science in modern times; ... [t]o pay attention to and give reasonable credence to their research and findings is to link the church of God with the highest increase of human thought and effort.[10]

However, by about 1930 this positive approach to science began to change. One indication was the dispute among Roberts, Joseph Fielding Smith, and James E. Talmage over the church's stance toward the theory of biological evolution.[11] This dispute arose when Roberts attempted to gain permission to publish The Truth, The Way, The Life as an official lesson manual, which Smith opposed because of its mention of "pre-Adamites." The matter ended inconclusively in 1931 when the First Presidency declined to publish Roberts's book and issued a memorandum declaring, "Leave geology, biology, archaeology and anthropology, no one of which has to do with the salvation of the souls of mankind, to scientific research, while we magnify our calling in the realm of the Church."[12]

Some LDS figures, mainly those of scientific or intellectual backgrounds, continued to advocate a positive and open-minded approach to scientific questions. An example was John A. Widtsoe, one of Mormon ism's first academically trained scientists and an apostle for several decades. In Evidences and Reconciliations he discussed, among other things, 

the increasing weight of evidence for an old earth and even presented a detailed tutorial on the technique of uranium isotope dating.[13] In an article published in the Improvement Era, he mentioned the existence of "human-like" beings before Adam and explained that "the mystery of the creation of Adam and Eve has not yet been revealed."[14]

Voices such as Widtsoe's came to reflect a minority view. In 1954, after Talmage, Roberts, and Widtsoe had passed away, Joseph Fielding Smith, with the encouragement of several other general authorities, published his manuscript Man: His Origin and Destiny.[15] Even though the book had not received official approval, it quickly gained widespread acceptance. Elder Smith's anti-science philosophies were further developed in subsequent works such as his Doctrines of Salvation.[16]

In these works Smith promoted a highly literal interpretation of the scriptures. On the age of the earth, he asserted that the earth's temporal existence "is to endure for just one week, or seven days of 1,000 years each."[17] He insisted that Noah's flood literally and completely immersed the earth.[18] He condemned the theory of evolution as "falsehood absolutely."[19] His views gained even greater circulation when they were cited in Bruce R. McConkie's popular reference Mormon Doctrine.[20]

During the 1950s, 1960s, and 1970s, some LDS authorities, notably David O. McKay and Hugh B. Brown, continued to emphasize a positive outlook on science. President McKay, who apparently believed in evolution, quietly assured those who inquired of his office that the church had not taken an official position on the issue.[21] Brown once declared, "We should be in the forefront of learning in all fields, for revelation does not come only through the prophet of God nor only directly from heaven in visions or dreams. Revelation may come in the laboratory, out of the test tube, out of the thinking mind and the inquiring soul, out of search and research and prayer and inspiration."[22]

Yet other leaders during this time emphasized the dangers of science. Mark E. Petersen raised concern about the "tenuous and fragile theory that the universe and all life came about in some mysterious spontaneous, accidental manner."[23] Harold B. Lee listed "science so-called" with communism as among the sources of "untruth" challenging the world.[24] Bruce R. McConkie termed Darwin's theory of evolution as one of the "seven deadly heresies."[25] Ezra Taft Benson urged members to use the Book of Mormon to combat falsehoods such as "socialism, organic evolution, rationalism, humanism."[26]

The Present Situation

So where do we stand today? One recent example of scientific commentary by an LDS general authority is a talk given by Elder Boyd K. Packer at a BYU Book of Mormon symposium in 1988, where he declared, 

It is my conviction that to the degree the theory of evolution asserts that man is the product of an evolutionary process, the offspring of animals—it is false! ... And, I am sorry to say, the so-called theistic evolution, the theory that God used an evolutionary process to prepare a physical body for the spirit of man, is equally false. ... How old is the earth? I do not know! But I do know that matter is eternal. How long a time has man been upon the earth? I do not know! But I do know that man did not evolve from animals. ... When confronted by evidence in the rocks below, rely on the witness of the heavens above.[27]

In spite of the fundamentalist tone in these excerpts, note that Elder Packer does not rule out plants and animals as possible products of an evolutionary process, nor does he rule out an old earth. In this regard he is more flexible than some of the other LDS authorities who have commented on these issues during the past few decades. 

There are other indications that the literalism which has dominated LDS literature during the last forty years may have peaked. In 1987, in response to numerous inquiries from readers on the subjects of fossils, the age of the earth, and related issues, the editors of the Ensign asked Morris Petersen, a professor of geology at BYU, to respond. He replied with a straightforward scientific explanation of the geological record, including evidence for the earth's great antiquity and the progression of fossils from primitive to highly advanced forms.[28] The fact that such an article could be published in the church's official organ, which requires official review, indicates that many LDS leaders are now comfortable with the conventional scientific picture of an old earth. 

Other examples are in the student lesson manuals used in the Church Education System (CES). The Old Testament manual currently used in institute classes, which was revised in 1981, takes a highly literalist approach. On the question of the age of the earth, the manual mentions the work of Velikovsky and Melvin Cook in defense of the position that the earth is only a few thousand years old. On the question of evolution, the manual includes several quotes by certain general authorities, which appear to rule out any possibility of a reconciliation with LDS doctrine, while leaving other viewpoints unmentioned. These quotes are followed by a lengthy excerpt (twenty-two paragraphs) from the writings of a Christian creationist.[29] Similar commentary appears in several other places. 

By contrast, the Old Testament manual currently used for seminary classes, which was revised in 1990, does not include any such material. Its only allusion to evolution is in a brief question, to be considered by the student, regarding the scripture "whose seed could only bring forth the same in itself, after his kind" (Abr. 4:12). The manual concludes its discussion of the creation with the admonition, "There are still many unanswered questions about how the earth was created, but these will be answered in the Lord's own due time."[30]

A third indication of a softening in the prevailing views on scientific issues is given in the new Encyclopedia of Mormonism,[31] which has at least semi-official status due to its sponsorship and rigorous review by the church. The article "Science and Religion," by Erich R. Paul, author of Science, Religion and Mormon Cosmology, briefly summarizes LDS commentary on the subject and then concludes that Latter-day Saints "look forward to a time when more complete knowledge in both areas will transcend all present perceptions of conflict." The article "Origin of Man," by John L. Sorenson of BYU, emphasizes that there are differing views on this issue and that the official position of the church is "not definitive."[32]

The article "Evolution," by William Evenson of BYU, is also telling. It is just a few paragraphs long, mainly a quote of the First Presidency's neutral statement in conclusion to the 1931 Roberts-Smith-Talmage dispute. For this particular article, at least three earlier and much longer drafts were reviewed and rejected by the First Presidency and other church leaders. The First Presidency then supplied the 1931 statement from their files, and the ensuing Encyclopedia article contains little more than this short statement. Incidentally, a slightly abbreviated version of this article is now distributed by church headquarters to people inquiring about evolution. Articles on other science-related topics, such as "Abortion," "Birth Control," "Homosexuality," "Medical Practices" and "Pro longing Life," are similarly moderate and open-minded, compared with discourse on these topics from decades past.[33]

Emerging Issues

In reviewing the history of discourse on scientific topics in LDS literature, one is struck by the large amount of space that has been devoted to a single topic: the apparent difficulty in reconciling modern biology, geology, and paleontology with the LDS creation scriptures. This issue was particularly at the forefront during the period from about 1950 to 1990. Those favoring a synthesis of faith and science can draw comfort from the articles in the Encyclopedia of Mormonism. Also encouraging to many scientifically-minded LDS are the successful efforts of BYU faculty and administrators in resisting periodic efforts to impose creationist biology there.[34] Along this line, in 1992 the Board of Trustees approved a packet of information on evolution to be made available for perusal by interested students at the library. It includes only a few statements by various First Presidencies while omitting a large number of less conciliatory (and less authoritative) statements by other church authorities. These developments are shallow victories, however, given that most members still hold fundamentalist beliefs on many scientific questions. For example, over 80 percent of BYU students in a 1973 survey did not believe that the Creation involved evolution.[35]

In any event, it might one day be lamented in LDS circles that such an inordinate amount of intellectual energy was expended during the twentieth century debating evolution and the age of the earth, while other, potentially more significant, questions were ignored. For it now seems clear that the twenty-first century will bring a host of such issues to the forefront. Among them are likely to be the following. 

1. The recent discovery of an "ozone hole" over Antarctica, and the increasing weight of evidence that this phenomenon is due to fluorine compounds emitted by the industrialized nations, has convinced many observers that the environmental crisis must be taken seriously.[36] Other crises include steadily growing levels of atmospheric carbon dioxide, due principally to the burning of fossil fuels, the destruction of tropical rain forests, and the ongoing extinction of numerous species of plant and animal life. Are there scriptural suggestions of these calamities? How should world governments respond? Is it prudent for the church to become involved in these matters? If so, should LDS members be instructed, especially in light of early church teachings and scriptures charging us with responsibility for stewardship over nature?[37]

2. Hand in hand with the environmental crisis is the burgeoning world population. LDS authorities have historically discouraged the practice of birth control, although the church's current official position on this issue is moderate.[38] In any event, the question of worldwide population control is coming explosively to the fore as it appears that the green revolution of the past few decades may have run its course and that the food supply cannot be increased much further without incalculable environmental damage.[39] In China, for example, even though a draconian birth control program has reduced the country's annual population growth rate to only 1.4 percent, the nation grows by 17 million people per year. Analysts project that by the year 2030 China alone could consume all the surplus grain produced in the world today, just to meet the most basic nutritional needs of its population.[40]

If pressure continues to build for limiting population around the world, what counsel should be given to prospective LDS parents on family size? Should families in all regions of the world be given the same counsel? 

3. Advances in biological science are certain to bring significant questions of medical ethics to the fore. An example is the detection of genetic defects by DNA analysis.[41] If a person is diagnosed with a hereditary genetic defect, should he or she still be encouraged to have children? Which defects are serious enough to justify formal or informal restrictions? One key question here is whether or when abortion should be considered for fetuses diagnosed with serious defects. At the present time the church's official condemnation of abortion excepts cases where "a severely defective fetus cannot survive birth."[42]

A related issue is the possible "cloning" of living organisms, including humans.[43] If this becomes possible, under what circumstances should it be done? Still another issue along this line is the commercialization of human gene therapies, as well as the creation and patenting of new species by genetic engineering.[44] What are the implications of such new technologies for traditional LDS teachings about a priori spirit creations in the pre-existence? 

4. Even though there have been advances in medical technology during the twentieth century, the pace of progress is likely to accelerate during the twenty-first. While these developments will be a boon to the majority of humankind, they are certain to pose more and more dilemmas in prolonging the lives of terminally ill patients.[45]

What portion of our resources should be devoted to extending the lives of those who at best have only a few months left, as opposed to measures that will improve the quality of life for others? When does meaningful life end? When should "the plug be pulled"? Is euthanasia ever warranted? Is a "brain-dead" person still alive in the LDS sense of being inhabited by a spirit? At the present time the church condemns any form of euthanasia, although it permits artificial life support systems to be disconnected after prayerful consideration.[46]

5. Recently scientists have found evidence that homosexuality is very probably partly determined by heredity and other biological factors. Other scientists vigorously contest this evidence.[47] Historically the church has regarded homosexuality as a sinful choice, although its current official position no longer condemns homosexual orientation per se.[48]

If the evidence for a biological connection grows stronger, how should the church respond? How might such developments affect the church's policy towards same-sex marriages? 

6. There are striking similarities between humans and certain animals, particularly primates, not only in anatomy, but also in behavior. Some animals have even been taught to use rudimentary language.[49] To what extent can animals think? What distinguishes us from the animal kingdom? How much of human behavior derives from an evolutionary past? How much of our "darker" nature can be overcome by individual agency? Can scientific research offer perspectives on the eternal struggle between good and evil? Would such findings be acknowledged or accepted by the church? 

7. The "big bang" cosmological theory is the currently accepted model for the origin and evolution of the universe, although some questions remain regarding its evolution since then.[50] How can the notion of a finite age universe be accommodated in LDS doctrine, which has historically taught that matter is eternal, and which has favored a steady-state cosmology? Was God the architect of the universe at the big bang? Does God exist in time and space, as a physical member of this universe, or does he exist elsewhere, beyond time and space?[51] If he exists beyond time and space, how can he influence our present world? 

8. Current formulations of the big bang cosmology seem to indicate that the fundamental laws of physics are exquisitely tuned to permit the existence of matter, stars, and sentient beings.[52] Are these facts evidence of the existence of a creator, or are there other, more prosaic explanations? Why does the universe exist at all? Why is there something and not nothing?[53]

9. Quantum theory, a cornerstone of modern physics, draws into question our basic notions of reality and causality. One of its assertions, that there is a fundamental uncertainty in all physical measurements, has been solidly confirmed in a number of experiments.[54] Furthermore, the emerging field of chaos theory tells us that many physical processes exhibit the "butterfly" property: an arbitrarily small change to present conditions can dramatically affect the future state of the system.[55] Thus there appear to be fundamental limits to our ability to predict future events.

How can God's foreknowledge and the principle of prophecy be interpreted in light of them? Do these theories shed any light on the principle of free agency?[56]

10. As noted above, LDS literature, especially in the nineteenth century, is replete with references to beings on other worlds. Indeed, many scientists have assumed that life must exist elsewhere, and they have investigated numerous scenarios for the detection of extra-terrestrial civilizations. Since at present the most reasonable approach appears to be the detection of microwave signals emitted by other societies, extensive astronomical searches of the microwave region of the electromagnetic spectrum are being conducted. Unfortunately, these and other scientific searches have so far turned up nothing.[57]

Are we alone? If not, where are these other beings? Is their biology based on carbon chemistry and DNA, like ours, or on a completely different biochemical system? How do they think, communicate, and govern themselves? What are their religious beliefs? If these searches continue to come up empty-handed, how might this affect LDS theological discourse? On the other hand, if intelligent life is detected elsewhere, how might this momentous discovery be accommodated, especially if that life turns out to have forms drastically unlike our image of God? 

11. Many people imagine that the work of a mathematician largely consists of repetitive and mechanical manipulations of mathematical expressions. In fact, the process of mathematical discovery is usually a highly intuitive process, with deep abstract contemplation followed by sudden bursts of brilliant insight. Often it takes months after this flash of insight to work out all the technical details.[58]

How is it possible to sense intuitively the outcome of a long train of abstract and difficult mathematical reasoning? If, as many philosophers believe, mathematical truths exist independent of the universe, human beings, and our particular physiology, how can our minds discover them? Is religious revelation another manifestation of this process? If so, what can be learned about revelation? Why does the universe appear to be governed by profound and elegant mathematical laws?[59]

12. A far-reaching discovery by twentieth-century mathematician Kurt Godel rules out the possibility of proving the logical consistency or completeness of formal mathematics. In other words, we can never be absolutely certain that the basic axioms used in mathematics are logically consistent; and even if we assume that they are, there will always be questions which cannot be answered either affirmatively or negatively.[60] In the field of fundamental particle physics, we already are pressing the limits of our ability to construct (and society's willingness to pay for) experiments that can decide among competing theories. Although some scientists remain optimistic that we will soon discover a "final theory" it may be that we will be forever frustrated in this quest. In any event, we can never be absolutely certain that we completely understand the fundamental laws of the universe or that our formulation of them is the most elegant possible.[61]

In other words, even in the two most "certain" and "precise" of the sciences, absolute certainty appears forever out of reach, and there may be questions which can never be conclusively answered. Do these principles have analogies in theology? Is God's knowledge limited in this manner? 

13. In recent years some scientists have speculated on the possibility of immortality, proposing various scientific scenarios for how this might be achieved. Some suggest that advances in technology predicted for the next few decades will result, among other things, in medicines that slow or even reverse the aging process. Others look forward to a time when humanity will free itself from its historic reliance on flesh, blood, and brainpower.[62] To what extent can doctrines such as immortality be submitted to scientific examination? Do LDS scriptures and literature offer insight into these questions? 

14. The phenomenon of human consciousness is being investigated by biologists, psychologists, physicists, philosophers, and even computer scientists. Some argue that it is fundamentally impossible to model or understand consciousness, while others dismiss such arguments and say that it is only a matter of time before computers can realistically model human thought.[63] What exactly is human consciousness? What is the relationship between consciousness and the "soul" or "spirit" in LDS theology? 

15. If the breathtaking pace of scientific and technological advancement of the past half-century is any clue, we will see new and intriguing developments in the twenty-first century that can now be only dimly imagined. How well will the LDS church cope with these advances? 

The Challenge of Science

Conflicts between science and religion are as old as recorded history. In the sixth century B.C.E. a mathematician in the Pythagorean philosophical school was able to prove that the diagonal of a square is incommensurate with its sides. In our modern mathematical terminology we would say he proved that the square root of two is an irrational number: it cannot be expressed exactly as the ratio of two whole numbers. This discovery precipitated a major crisis for the Pythagorean school and its numerology-based religion, since one of its fundamental beliefs was the assumption that all reality could be described by using whole numbers. The school reportedly drowned one of its number who publicly discussed this unsettling discovery.[64]

In the Middle Ages growing exposure to ancient Greek and Middle Eastern writings caused considerable consternation among medieval Christian theologians. As a single incredible example, theologians were once disturbed at the discrepancy between the biblical value of the ratio between the circumference and diameter of a circle, namely 3.0 (based on the dimensions of the circular pool in King Solomon's temple [1 Kgs. 7:23; 2 Chron. 4:2]), and the more accurate values (approximately 3.14159) obtained by mathematicians in ancient Greece and medieval Europe. As late as the eighteenth century Bible commentators were still attempting to explain away this discrepancy, using such imaginative dodges as speculating that the circular pool in Solomon's temple was really hexagonal in shape.[65]

The most serious challenge of the expanding corpus of scientific knowledge was to the geocentric, flat-earth cosmology that had been assumed in the Judeo-Christian world for centuries. Many Christian scholars, who noted the numerous instances in the Bible of the "four corners," the "foundations," the "pillars," and the "ends" of the earth (see 1 Sam. 2:8; 2 Sam. 22:16; Job 28:24,38:4; Ps. 75:3,102:25; Isa. 11:12; Heb. 1:10; Rev. 7:1), could not see how these scriptures could be reconciled with the scientific notion of a spherical earth. The last straw for these theologians was Copernicus's heliocentric cosmology, in which the earth was but one of several planets orbiting the sun. Many felt that this cosmology was so clearly incompatible with numerous biblical scriptures (see Josh. 10:12-13; Job 9:6-7; Ps. 93:1, 104:5; Eccl. 1:5; Amos 8:9) that both the Bible and the church would lose their authority if it prevailed. The Jesuits considered the theory more dangerous than the heresies of Luther and Calvin. The Inquisition forced Galileo to recant his arguments in support of it.[66] Martin Luther, who taught that the Bible was the infallible word of God, rejected the Copernican theory because Joshua commanded the sun, not the earth, to stand still Josh. 10:12-13).[67] In the nineteenth century similar warnings were voiced in Catholic and Protestant circles about Darwin's theory of evolution. The same is true to a lesser extent in the twentieth century about theories such as the "big bang." 

If there is a lesson to be learned from these examples, it is that scientific challenges which may seem to present insuperable difficulties for religious faith in one era are almost always found to be compatible with faith in another. The Bible today still contains the many passages that reflect the geocentric, flat-earth cosmology of antiquity; yet only the most ardent literalists lose sleep over them. It is now widely appreciated that the writers of the Bible wrote from their own world view, often in a poetic style, and no one expects that they could have anticipated every principle of modern science. Similarly, while many are still uncomfortable with the theory of evolution, others now view it as an elegant and effective mechanism used by God in the process of creation. Some further argue that any attempt to read the scriptures as scientific documents, against the intent of the original writers, only obscures the deeper spiritual messages contained in them.[68]

How can the LDS church best cope with the challenges of science during the next century? Some Mormons may dismiss such issues, believing that the second coming of Jesus Christ will occur soon after the turn of the century, thus rendering these issues moot. But others note scriptures such as Matthew 24:36 and conclude that we must face these issues. 

On one hand, it seems clear that if the church adopts, even implicitly, a strict, fundamentalist approach, with a rigid creed that precludes a harmony between science and religion, then it risks losing many educated members, especially in developed countries like the U.S., Canada, Eu rope, and Japan. Particularly at risk are young Latter-day Saints at colleges and universities, who usually lack the sophistication to see beyond superficial conflicts to the deeper issues. The tensions that many of these students now experience will only increase if they are required to choose between the increasingly dominant world of scientific knowledge and a narrowly defined religious orthodoxy. 

For example, recently there has been an explosion of scientific discoveries in molecular biology and evolution. These include DNA computing,[69] the recovery and analysis of ancient dinosaur DNA fragments,[70] the resuscitation of 25-million-year-old microbial spores,[71] and the tracing of modern humans to a common ancestor of 270,000 years ago.[72] Among other things, such developments herald a new era in biological research, one that Darwin in his wildest dreams might not have imagined possible: the direct study of the course of evolution (including human evolution) at the DNA level through eons of time. Imagine the dilemma faced by a young college student, particularly one with aspirations for a scientific career, who is bombarded by news of these exciting discoveries in the academic environment but hears only creationist doctrines and somber warnings of the dangers of science in his/her church environment. Fortunately, as mentioned, there are indications that the scriptural literalism which has dominated LDS science discourse in recent decades may be giving way to a more open-ended approach. It remains to be seen, however, if this approach will be truly acceptable to church leaders or rank-and-file members, many of whom have adopted a highly literal understanding of scripture. 

On the other hand, an isolationist approach appears equally doomed to failure in a world increasingly pervaded by science and technology. Some separation of science and religion is certainly appropriate: surely there is no point in the church's delving into matters which are largely irrelevant to its theology or which are still highly tentative from a scientific point of view. Even in most other cases it may well be best for the church simply to remain silent. It is certainly unwise for anyone in the church to make seemingly "final" statements about anything in the ever-expanding world of scientific knowledge. 

Yet if Mormonism is isolated from science, or if meaningful discussion of scientific topics is ruled off-limits in the church, then it risks being viewed as sterile and irrelevant. Widtsoe warned about such an isolationist approach: "Scientific truth cannot be theological lie. To the sane mind, theology and philosophy must harmonize. They have the common ground of truth on which to meet."[73] In a similar vein physicist-theologian Frank J. Tipler recently warned, "If religion is permanently separated from science, then it is permanently separated from humanity and all of humanity's concerns. Thus separated, it will disappear."[74] Thus one hopes that the church and its members will steer a middle course, applying their collective gifts of intelligence and inspiration to careful consideration of these matters and their significance for the LDS faith. Certainly LDS scientists must participate in this dialogue. We thus look forward to an improvement, as we enter the next century, in the intellectual atmosphere that heretofore has often seemed so tense. 

Fortunately, the church has one important advantage over many other religious denominations in dealing with the challenges of science: its fundamental belief in continuing revelation, as declared in the ninth Article of Faith. One implication of this principle is that current church teachings at any given point in time should never be considered final, absolute, complete, or infallible. Instead, they should be considered as representing the best present understanding and certainly subject to change as knowledge and understanding grow. 

Conclusion

An ancient Chinese curse holds: "May you live in interesting times." Clearly we find ourselves living in "interesting times" today. For every scientific development that seems to pose a difficult challenge to religion in general and to the LDS religion in particular, another suggests that genuine faith can be successfully enlarged to accommodate modern scientific discoveries, with both science and religion being enriched in the process. As religious historian Karen Armstrong observed: "In our scientific age, we cannot think about God in the same way as our forebears, but the challenge of science could help us to appreciate some old truths."[75] In fact, there is sublime, spiritually-rewarding pleasure in discovering truths previously known only to God. Perhaps it is a good thing that he always holds some of the most fascinating and fundamental truths just beyond our research so that we always have something to seek for and wonder about. Perhaps within our lifetimes we will be able to answer some of the above questions of science and religion. If so, then we will come one step closer to "knowing the mind of God."[76]

---

[1] From Ralph Waldo Emerson's journal, cited in J. L. Davis et al., eds., A Treasury of American Literature (New York: Grolier, 1948), 1:703. 

[2] Duane Jeffery, "Seers, Savants and Evolution: The Uncomfortable Interface," Dialogue: A Journal of Mormon Thought 8 (Autumn 1974): 41-75. 

[3] Erich R. Paul, Science, Religion, and Mormon Cosmology (Urbana: University of Illinois Press, 1992). Sadly, Paul died of cancer in October 1994.

[4] Times and Seasons 4 (15 Dec. 1842): 46. 

[5] Journal of Discourses, 26 vols. (Liverpool, Eng.: Latter-day Saints' Bookseller's Depot, 1855-88), 7 (12 Feb. 1860): 157. 

[6] Parley P. Pratt, Key to the Science of Theology (London, 1855), 2. 

[7] Journal of Discourses 7 (6 Oct. 1850): 271; 8 (3 June 1860): 278; 9 (31 Aug. 1862): 369; 13 (25 Sept. 1870): 247-48; 14 (14 May 1871): 116; 15 (11 Aug. 1872): 127. 

[8] Brigham H. Roberts, The Truth, The Way, The Life: An Elementary Treatise on Theology (San Francisco: Smith Research Associates, 1994). 

[9] Ibid., 260-74, 339-64. 

[10] Ibid., 363-64.

[11] Richard Sherlock, "We Can See No Advantage to a Continuation of the Discussion: The Roberts/Smith/Talmage Affair," Dialogue: A Journal of Mormon Thought 13 (Fall 1980): 63-78. 

[12] Ibid., 71. 

[13] John A. Widtsoe, Evidences and Reconciliations (Salt Lake City: Bookcraft, 1951), 149.

[14] John A. Widtsoe, "Were There Pre-Adamites?" Improvement Era 51 (May 1948): 205.

[15] Joseph Fielding Smith, Man: His Origin and Destiny (Salt Lake City: Deseret Book Co., 1954). 

[16] Joseph Fielding Smith, Doctrines of Salvation, 3 vols. (Salt Lake City: Bookcraft, 1956).

[17] Ibid., 1:80.

[18] Smith, Man, 414-36. 

[19] Smith, Doctrines, 1:140. 

[20] Bruce R. McConkie, Mormon Doctrine, 2d ed. (Salt Lake City: Bookcraft, 1966), 256.

[21] William L. Stokes, "An Official Position," Dialogue: A Journal of Mormon Thought 12 (Winter 1979): 90-92; David O. McKay, A Message for LDS College Youth (Provo, UT: BYU Extension Publications, 1952), 6-7; Conference Reports, Apr. 1968,92; Gospel Ideals (Salt Lake City: Improvement Era Publications, 1953), 49; Sterling M. McMurrin and L. Jackson Newell, "McMurrin's Heresies, History, and Humor," Sunstone 18 (Apr. 1995): 55-62. 

[22] Edwin B. Firmage, ed., An Abundant Life: The Memoirs of Hugh B. Brown (Salt Lake City: Signature Books, 1988), 139. 

[23] Mark E. Petersen, "Creator and Savior," Ensign 13 (May 1983): 63-65.

[24] Harold B. Lee, Conference Report, Apr. 1964,21-25; also Oct. 1968,59-62.

[25] Bruce R. McConkie, "The Seven Deadly Heresies," BYU Fireside, 1 June 1980, transcript in my possession. 

[26] Ezra Taft Benson, The Teachings of Ezra Taft Benson (Salt Lake City: Bookcraft, 1988), 60. Benson did acknowledge the scientific evidence for evolution; see Steve Benson, "Ezra Taft Benson: A Grandson's Remembrance," Sunstone 17 (Dec. 1994): 29-37.

[27] Boyd K. Packer, "The Law and the Light," in Monte Nyman and Charles D. Tate, eds., To Learn With Joy (Provo, UT: BYU Religious Studies Center, 1990). This published version of Packer's 1988 speech was prefaced with a strong disclaimer by the editors. 

[28] Morris Petersen, "Fossils and Scripture," Ensign 17 (Sept. 1987): 28.

[29] Old Testament: Genesis—2 Samuel Student Manual (Salt Lake City: Church of Jesus Christ of Latter-day Saints, 1981), 28-29, 33-36.

[30] Seminary Old Testament Student Manual (Salt Lake City: Church of Jesus Christ of Latter-day Saints, 1990), 18-19. 

[31] Daniel H. Ludlow, ed., The Encyclopedia of Mormonism, 4 vols. (New York: Macmillan, 1992). 

[32] "Science and Religion," Encyclopedia, 3:1270-72; "Origin of Man," 3:1053-54. 

[33] "Evolution," Encyclopedia, 2:478; "Abortion," 1:7; "Birth Control," 1:116-17; "Homo sexuality," 2:655-56; "Medical Practices," 2:875; "Prolonging Life," 3:1159-60.

[34] Gary J. Bergera and Ronald Priddis, Brigham Young University: A House of Faith (Salt Lake City: Signature Books, 1985), 131-71. 

[35] Armand L. Mauss, The Angel and the Beehive (Urbana: University of Illinois Press, 1994), 179. According to BYU zoologist Duane Jeffery (private communication), BYU students today are at least as literalist in their beliefs on evolution as they were in 1973. 

[36] Owen B. Toon and Richard P. Turco, "Polar Stratospheric Clouds and Ozone Depletion," Scientific American 264 0une 1991): 68-75; Sasha Nemecek, "Holes in Ozone Science," Scientific American 272 (Jan. 1995): 26-27.

[37] Larry L. St. Clair and Clayton C. Newberry, "Consecration, Stewardship, and Accountability: Remedy for a Dying Planet," Dialogue: A Journal of Mormon Thought 28 (Summer 1995): 93-99. 

[38] Lester E. Bush, Jr., Health and Medicine Among the Latter-day Saints (New York: Cross road, 1993), 152-59; Smith, Doctrines, 2:87; Ezra Taft Benson, Conference Report, Apr. 1969, 10-15; Mark E. Petersen, The Way to Peace (Salt Lake City: Bookcraft, 1969), 266; Encyclopedia, 1:116-17. 

[39] John Bongaarts, "Can the Growing Human Population Feed Itself?" Scientific American 270 (Mar. 1994): 36-43. 

[40] Eugene Linden, "Showdown in Cairo," Time 144 (4 Sept. 1994): 52-53.

[41] Philip Elmer-Dewitt, "The Genetic Revolution," Time 143 (17 Jan. 1994): 46-57.

[42] Bush, Health and Medicine, 159-67; Encyclopedia, 1:7. 

[43] Philip Elmer-Dewitt, "Cloning: Where Do We Draw the Line," Time 142 (8 Nov. 1993): 64-67.

[44] Richard Stone, "Religious Leaders Oppose Patenting Genes and Animals," Science 268 (26 May 1995): 1126; Kenneth L. Woodward, "Thou Shalt Not Patent!" Newsweek, 29 May 1995,68-69. 

[45] C. Everett Koop and Timothy Johnson, Let's Talk—An Honest Conversation on Critical Issues (Grand Rapids, MI: Zondervan Press, 1992), 39-60. 

[46] Bush, Health and Medicine, 36-39; Encyclopedia, 3:1159-60. 

[47] Simon LeVay and Dean H. Hamer, "Evidence for a Biological Influence in Male Homosexuality," Scientific American 270 (June 1994): 44-49; William Byne, "The Biological Evidence Challenged," Scientific American 270 (June 1994): 50-55; Larry Thompson, "Search for a Gay Gene," Time 145 (12 June 1995): 60-61. 

[48] Bush, Health and Medicine, 173-78; Benson, Teachings, 280; Spencer W. Kimball, The Miracle of Forgiveness (Salt Lake City: Bookcraft, 1969), 78-89; Encyclopedia, 2:655-56.

[49] Carl Sagan and Ann Druyan, Shadows of Forgotten Ancestors (New York: Random House, 1992); Eugene Winden, "Can Animals Think?" Time 141 (22 Mar. 1993): 54-63.

[50] Corey S. Powell, "The Golden Age of Cosmology," Scientific American 267 (July 1992): 17-22; R. Cowen, "Hubble Telescope Eyes a Younger Universe," Science News 146 (29 Oct. 1994): 278; Michael D. Lemonick and J. Madeleine Nash, "Unraveling Universe," Time 145 (6 Mar. 1995): 77-84. 

[51] Robert Wright, "Science, God and Man," Time 140 (28 Dec. 1992): 38-44; Paul Davies, God and the New Physics (New York: Simon and Schuster, 1983). 

[52] Paul Davies, The Accidental Universe (New York: Cambridge University Press, 1982); John D. Barrow and Frank J. Tipler, The Anthropic Cosmological Principle (New York: Oxford University Press, 1986); Steven Weinberg, "Life in the Universe," Scientific American 271 (Oct. 1994): 44-49. 

[53] Andrei Linde, "The Self-Reproducing Inflationary Universe," Scientific American 271 (Nov. 1994): 48-55; Paul Davies, The Mind of God (New York: Touchstone, 1992), 39-72, 161-93; Steven Hawking, A Brief History of Time (New York: Doubleday, 1988). 

[54] Abner Shimony, "The Reality of the Quantum World," Scientific American 258 (Jan. 1988): 46-53. 

[55] James Gleick, Chaos: Making a New Science (New York: Viking Penguin, 1987).

[56] See David B. Timmins, "Free Agency, Determinism, and Chaos Theory," Dialogue: A Journal of Mormon Thought 28 (Fall 1995): 163-70. 

[57] Barrow and Tipler, 576-612; Paul, 193-227; Carl Sagan, "The Search for Extraterrestrial Life," Scientific American 271 (Oct. 1994): 92-99; Carl Sagan, Pale Blue Dot: A Vision of the Human Future in Space (New York: Random House, 1994), 351-65. 

[58] John D. Barrow, Pi in the Sky: Counting, Thinking and Being (New York: Little Brown and Co., 1992); Robert Kanigel, The Man Who Knew Infinity (New York: Washington Square Press, 1992); Barry Cipra, "Princeton Mathematician Looks Back on Fermat Proof," Science 268 (26 May 1995): 1133-34. 

[59] Davies, Mind, 140-60.

[60] Barrow, Pi; Douglas R. Hofstadter, Godel, Escher, Bach: An Eternal Golden Braid (New York: Random House, 1979). 

[61] Steven Weinberg, Dreams of a Final Theory (New York: Vintage Books, 1994); John Horgan, "Particle Metaphysics," Scientific American 270 (Feb. 1994): 96-106; David Lindley, The End of Physics (New York: Basic Books, 1993); Davies, Mind. 

[62] K. Eric Drexler, Engines of Creation: The Coming Era of Nanotechnology (New York: Doubleday, 1990); Marvin Minsky, "Will Robots Inherit the Earth?" Scientific American 271 (Oct. 1994): 108-13; Frank J. Tipler, The Physics of Immortality (New York: Doubleday, 1994). 

[63] Barrow, Pi; Hofstadter, Godel; Minsky, "Robots"; Tipler, Immortality; John Horgan, "Can Science Explain Consciousness?" Scientific American 271 (July 1994): 88-94.

[64] Bertrand Russell, Wisdom of the West (London: Crescent Books, 1959), 22; D. W. Ham lyn, A History of Western Philosophy (New York: Viking Penguin, 1987), 18-19.

[65] Petr Beckmann, A History of Pi (New York: St. Martin's Press, 1971), 75-76. Beckmann references a seven-volume history of mathematics, in German, by Jerome Tropfke, published in 1923. Tropfke in turn quotes original eighteenth-century sources.

[66] Will and Ariel Durant, The Story of Civilization (New York: Simon and Schuster, 1961), 7:600-12. 

[67] Ibid., 6:858. 

[68] Keith E. Norman, "Adam's Navel," Dialogue: A Journal of Mormon Thought 21 (Summer 1988): 81-97; Karen Armstrong, A History of God (New York: Knopf, 1993), 395; John S. Spong, Rescuing the Bible from Fundamentalism (New York: Harper, 1991), 25-36.

[69] Leonard M. Adleman, "Molecular Computation of Solutions to Combinatorial Problems," Science 266 (11 Nov. 1994): 1021-23; Robert Pool, "A Boom in Plans for DNA Computing," Science 268 (28 Apr. 1995): 498-99. 

[70] Richard Monastersky, "Dinosaur DNA: Is the Race Finally Over?" Science News 146 (19 Nov. 1994): 324; Ann Gibbons, "Possible Dino DNA Find Is Greeted with Skepticism," Science 266 (18 Nov. 1994): 1159. The researcher here is Scott Woodward of BYU. 

[71] Raul J. Cano and Monica K. Borucki, "Revival and Identification of Bacterial Spores in 25- to 40-Million-Year-Old Dominican Amber," Science 268 (19 May 1995): 1060-64; J. Madeleine Nash, "Return of the Living Dead?" Time 145 (29 May 1995): 55-56. 

[72] Svante Paabo, "The Y Chromosome and the Origin of All of Us (Men)," Science 268 (26 May 1995): 1141-42; Robert L. Dorit, Hiroshi Akashi, and Walter Gilbert, "Absence of Polymorphism at the ZFY Locus on the Human Y Chromosome," Science 268 (26 May 1995): 1183-85.

[73] John A. Widtsoe, Joseph Smith as Scientist (Salt Lake City: Bookcraft, 1964), 156.

[74] Tipler, Immortality, 332. 

[75] Armstrong, 395.

[76] See Hawking, 175; and Davies, Mind of God.

[post_title] => Science and Mormonism: Past, Present, Future [post_excerpt] => Dialogue 29.1 (Spring 1996): 80–97
Will the church be able to retain the essence of its theology in the faceof challenges from science? Will the church’s discourse on scientific topicsbe marked by fundamentalism, isolationism, or progressivism? Will the church be able to retain its large contingent of professional scientists? [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => science-and-mormonism-past-present-future [to_ping] => [pinged] => [post_modified] => 2024-01-28 16:42:34 [post_modified_gmt] => 2024-01-28 16:42:34 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=11454 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 16174 [post_author] => 3136 [post_date] => 2018-04-18 22:42:49 [post_date_gmt] => 2018-04-18 22:42:49 [post_content] =>

One does not have to go beyond the title of Darwin's book, The Origin \of the Species by Means of Natural Selection (1859), before getting into deep philosophical and theological waters. What does the word origin connote? Are we dealing with an ontological problem, a genuine coming into being, or with change? 

While the study of change is the proper domain for scientific inquiry, the origin of something, in the sense of its "coming into being out of nothing," is beyond the scope of science. But the distinction between change and origin is more ideal than real because the scholar can never be certain that his or her quest has reached the source. By using the term origin in the title of a scientific treatise, Darwin was signaling that the species need not, or perhaps should not, be considered direct creations of God. 

Some leaped to the conclusion that Darwin's aim was to secularize the universe by denying God his most impressive work, but nothing could be further from the truth. Darwin simply sought to discover which of the world's phenomena were explicable by chains of causality. The great bulk of his intellectual effort was devoted to this enterprise; Darwin believed it an error to concede a phenomenon to God's direct intervention without first attempting to find an intermediate cause. Such a path would not only deny him an intellectual pleasure that he did not consider the least sinful; but, more importantly, it would block the progress of human inquiry. 

The next word of significance in the title is species, a term then synonymous with Platonic form or the Aristotelean essence. To Darwin, however, and in deed to most contemporary biologists, the word species has lost its essentialist connotation and now refers to a group of individuals that share a recent common heritage. For those that reproduce sexually, a species exists when any pair of individuals within the group have the same chance of begetting fertile offspring. Biologists delight in distinguishing species that are so close in form that none but the expert can tell them apart, but which are deemed species nonetheless for they are either unable to mate with each other, don't care to mate, or if they do, either produce sterile offspring or none at all. 

The contemporary creationist, on the other hand, still refers to species in the essentialist sense and, to emphasize the distinction, prefers to talk about "kinds" which usually correspond to larger taxonomical categories. Aristotle was not averse to intuiting essences nor are today's creationists. But their propensity for so doing presents a problem because the ontological status enjoyed by kinds in an Aristotelian world has no counterpart in the empirical realm of a scientist. In short, created species would be essentially distinct from species that arise by modification through descent. The former are necessary and the latter contingent. Even so, modern-day creationists do not object to, and indeed embrace, the notion of natural selection (or artificial selection) as an agent for the emergence of varieties. 

Accompanying the emergence of these philosophical distinctions, has come a substantial change in what we define as knowledge and how we go about acquiring it. Not only did Darwin live at a time that witnessed a sharp transition in the canons of knowing, but he was one of the first to comprehend what was entailed in this shift. 

This epistemological change had its roots in the Protestant Reformation. Prior to the sixteenth century, the medieval Christian world relied on a system of belief forged from Aristotelian ontology and biblical doctrine. In this system the universe was almost divorced from God; natural phenomena were manifestations of immanent forms and causes rather than the consequence of direct superintendence by deity. Medieval Christians sought to understand the world in terms of the four Aristotelian causes — the material cause (or substance), the formal cause (the design), the efficient cause (the maker), and the final cause (the purpose). While today we stress the efficient cause (or process), Aristotle's greatest emphasis was on the final cause. The why of things, or the goal of inquiry, was teleological, the method rational. 

With the Reformation, the Greek philosophical tradition, with its premise that the mind of man could discover the rational elements in nature, was largely submerged and replaced by Hebrew doctrine, built around a Creator God and a universe that was both orchestrated and explained by divine command. With this profound change in religious outlook came a new episteme where one sought to decipher God's purpose and nature by close examination of nature itself, rather than by consulting the furnishings of one's mind. Exemplifying this new climate of opinion, seventeenth-century thinkers like Galileo, Kepler, and Newton sought not so much to find out why things happened as to discern how they happened. Francis Bacon consciously shifted from the deductive to the inductive method of inquiry, stimulated by his vision of scientific discoveries being employed in the service of society. But even Bacon, for all his proclaimed empiricism, succumbed to the allure of certainty by relying on an intuitive apprehension of truth suggested by his application of inductive processes. In doing this he strayed from the rigorous example of his predecessor, William of Ockham, who also recognized the two domains of knowing but insisted that the fruits of empirical inquiry were always tentative. 

While empirical for the most part, the scientists of the seventeenth century had not yet become thoroughly positivist in orientation or method. They continued to mix their new knowledge, acquired from observation and evaluation, with traditional assumptions about the origins and purposes of natural phenomena. 

The extension of this growing conscious aspiration for a strictly positivist explanation of things was one of Darwin's two great contributions to science. He expanded the scope of scientific inquiry to include all reliably observable phenomena. But, as his journals reveal, he experienced no sudden conversion. He crept toward positivism. As he gingerly embraced it, however, with a growing awareness that the world may come to be comprehensible without resort to a creator, he experienced considerable unease and, at times, an almost intolerable anxiety. 

Darwin was the first modern scientist in that he both practiced and believed in positivism, although others foreshadowed his approach. Newton is a classic example, postulating the law of gravity as the explanatory principle for planetary motion. Closer in time to Darwin, Charles Lyell reiterated and popularized Hutton's theory that the geomorphology of the earth could be explained by observed natural phenomena working over the millennia, without requiring supernatural events to account for massive reworking of the earth's crust. 

In looking to nature to explain natural phenomena, Lyell's approach was governed by his notion of uniformitarianism, but this principle occasionally led him beyond positivism back into the realm of theistic metaphysics. For instance, he strongly opposed the idea of progress in natural history. He was caught up in the Newtonian view of the world, where, like a clock, nature goes round and round — cycling but getting nowhere. This a priori conviction made it almost impossible for him to come to terms with Darwin's theory of evolution and the progress it implies for life. 

For Newton, the doing of science was a form of religious devotion. Yet his methods were thoroughly positivist. He sought to deduce forces by observing motions and then by testing the forces so identified by predicting still other motions. In the same manner, Darwin sought to explain changes in species by the "force" of natural selection working on genetic variation. And just as Newton argued analogically from the terrestrial fall of the apple to the celestial fall of the moon in the earth's gravitational field to account for the origin of species, Darwin analogized from man-caused selection (noting the successes of animal breeders) to the possibility of natural selection (based on the survival of the fittest). 

Despite this similarity between the methods of Darwin and Newton, there is a striking contrast in their use of hypotheses. For Newton, the purpose of science was to discover mathematical language to explain divine prescriptions or natural laws. He was explicitly hostile to the notion that the progress of science was as dependent on the forming and testing of hypotheses as on the discovery of laws. While he correctly refused to speculate on how the force of gravity came to be, he failed to distinguish between idle speculation and productive hypothesis. Darwin was confronted with his own mystery in his theory of evolution; how did variation come to be? He struggled unsuccessfully to account for genetic mutation in positivist terms. For liberal Christian evolutionary apologists, however, this lacuna in his theory provided the loophole for God's intervention and thus allowed them to embrace Darwin's theory. 

I am sure that if Newton were reincarnated as a modern biologist, he would be a population geneticist happily plotting gene-frequency changes and deducing therefrom the magnitude of the selective force. But he would have eschewed the problem of the origin of the species as being mathematically intractable. Even so, when Newton broke his own rule and waxed metaphysical about absolute time and space, Berkeley attacked him as being atheistic. Stung, Newton responded by adding a statement to the second edition of Principia wherein he declared the full dominion of God everywhere. To Newton the universe moved in God, in God's sensorium no less, absolute space being a metaphor for God in which he moved bodies by his will, almost as if the Universe is the mind of God. Newton could not proclaim a greater immanence for God: in his mind science and God's will were coextensive. 

Newton's view stood in sharp contrast to Darwin, who insisted, for the sake of the advancement of knowledge, that science and theology be kept apart. He worked from a kind of epistemological apartheid, where the two worldviews would be regarded as separate, but equal. As we have painfully experienced in other realms, partitioning is sure to leave one or both parties feeling slighted. Darwin's scientific work precipitated a controversy that is still with us after 120 years. 

In his 1979 book, Charles Darwin and the Problem of Creation (Chicago: University of Chicago, 1979), Neil C. Gillespie argues that as science progressed, and the pragmatic fruitfulness of the positivist approach became increasingly apparent, reference to the Creator became more a matter of ritual than of logical necessity in scientific explanations. With a growing interest in secondary causes among scientists, the ritual itself eventually evaporated. While this seems to have been the case in chemistry, physics, and perhaps geology, it was not so in biology — and certainly not among those who wrestled with the origin of species. Thus, for his insistence that science be restricted in its scope and not conflated with religion, Darwin was confronted by and isolated from the Christian scientific community. When some of his contemporaries embraced evolution to explain the fossil record but resorted to a deistic mechanism to account for it, Darwin complained in 1838, "The explanation of types and structure in classes — as resulting from the will of the deity, to create animals on certain plans — is no explanation — it has not the character of a physical law and is therefore utterly useless. It foretells nothing because we know nothing of the will of the deity, how it acts and whether constant or inconstant like that of man. The cause given we know not the effect."[1]

The final element in Darwin's title is the term "natural selection," the ana logical element in his positivist theory. The rank materialism of the mechanism added insult to the already injured idealists, theists, deists, and Aristotelian scholastics. With foresight and prudence, Darwin elected to postpone the obvious extension of this theory to the origin of man, due to its great threat to man's dignity, which Darwin believed was overblown. Even so, it was the materialist mechanism for evolution that presented both the most persuasive argument for evolution and the greatest problem for the Christian communities, laymen and theologians alike. 

Inspired by Paley's proof of God's existence based on his argument from design in nature, Darwin saw natural selection as the agent for diversifying species — working on the raw material of natural variation wherein separate individuals left progeny in proportion to their adaptation to their environment and their attractiveness to the opposite sex. But Darwin's theory of the origin of species replaced Paley's divinely designed contrivance with a process more akin to a Rube Goldberg contraption than to God's handiwork. In doing this Darwin enlarged the role of natural selection from simply ensuring survival of the fittest (within species) to the creative role of generating new species. 

In positing this mechanism of evolution, Darwin brought into sharp focus differences in theological opinion about how the universe was divided into divine and secular phenomena. Opinions ranged widely. On the one hand were those who believed God created the universe —- setting it in motion so perfectly that there was no need for his continued presence to keep it going. Such a division between the initial creative role of God and secondary consequences operating as natural laws provided a wide berth for scientific inquiry. 

At the other end of the scale were those who envisioned God superintending his creation throughout time and space. In this view, God was actively and ubiquitiously present. One would expect that this view leaves little scope for scientific inquiry. In thinking this, however, we underestimate the possibilities of innovative theological thinking. Some theologians who favored this notion of God argued that since deity is constantly superintending the universe, there is no need for him to intervene in his own works, and thus all the happenings of the universe, from its smallest to its greatest events, are governed by divine, orderly law. To the extent that God was seen as an orderly being, this view was congenial to scientific inquiry, though it did not encourage it. Other theologians argued for an intermediate position in which God intervened from time to time, either miraculously or according to natural law. The intermittent expression of divine will, of course, was seen as a barrier to scientific inquiry. Corresponding to this range of theological possibilities, it was not surprising that Darwin's theory could be assimilated by a Christian worldview without shaking its foundations any more than they were already shaken by its own theological divisions. As science expanded its capacity to explain the universe, theologians no longer had the field to themselves. Their devices of accommodation were various. 

For some orthodox Christians, like two of Darwin's great defenders in America, botanist Asa Grey and glaciologist Frederick Wright, it was the Achilles' heel of Darwin's theory, namely the origin of the genetic variation, that provided a loophole for God's superintendence. By creating variation, God indirectly guided evolution. This argument by Darwin's strongest sup porters in America led to an exchange of letters in which each party, with great courtesy, attempted to persuade the other. Each acknowledged the power of the other's argument, but neither changed the other's assumptions. 

The idea of evolution was also accommodated by some of liberal theological persuasion, such as British anatomist, Richard Owen, and American dinosaur hunter and paleontologist Edward Drinker Cope. Unfortunately, their accommodation was hopelessly compromised as far as Darwin was concerned because the mechanism for change was not natural selection at all but a throwback to Aristotelian teleology, whereby a mystical indwelling force drives a divine plan to produce a progression of species leading to man. In this deistic view of the origin of species, God's creative act is direct in originating the first life form and in providing in it the potential for, and guidance of, evolutionary progress. 

One cannot leave this subject without commenting on the most intriguing and radical explanation of evolution. I refer to the theory put forward by Harvard nineteenth-century zoologist, Louis Agassiz. Agassiz was a "catastrophic creationist" who argued from the study of the fossil record illuminated by his faith that the earth was repeatedly devastated by a series of catastrophes and then repopulated by a succession of special creations, culminating in the crowning creation of man. 

Collectively, these theological accommodations of Darwinian theory may be identified as providential evolution. It was against those who held such views of evolution, rather than against those who refused to contaminate their biblical doctrine with any accommodation, that Darwin felt most obliged to struggle. In loading the positivist core of their explanations for the origin of species with theological freight, they presented a threat to the intellectual integrity of Darwin's theory. Like wolves in sheep's clothing, Darwin might have said, they would cause many to overlook the distinction between the old episteme that awkwardly linked positivism and theology and the new, strictly secular, positivism that Darwin so energetically strove to establish as the basis for modern science. 

Despite all his scientific passion, however, Darwin was sometimes repelled by the stark implications of a totally materialist vision of the universe and man's place in it. In these moments he found it impossible to believe that God had no part in the creation of life. But even on these occasions, his glimmer of hope would be quenched by his relentless curiosity: he wondered if a belief in God might itself be an adaptive strategy generated by natural selection. 

Even since the rhetorical excesses of the famous 1860 debate between Bishop Wilberforce and Thomas Huxley, the proponents of evolution and special creation have warily circled each other, bursting into episodes of attack and counterattack, as in the Scopes trial in Tennessee and more recently in the First Amendment Case in Arkansas. Reinhold Niebuhr rather nicely summed up this situation in his essay written for the Centenary of Darwin's Origin of the Species. He observed that scientists tend to view the pious as "telling a lot of little lies in the interest of great truth," while the religious see science as "telling a lot of little truths" which could be fashioned into a "big lie."[2]

The big question for me in this controversy is whether freedom of inquiry, with the agonizing ambiguity that accompanies it, will be sacrificed to the interests of those who demand certainty in the hope of salvation. It cannot be denied, as Sterling McMurrin has pointed out, that the fundamentalists have their eyes firmly fixed on personal salvation. They will not risk the bastian of their faith — their belief in the inerrancy of the scripture — to accommodate those who seek to increase knowledge through the processes of modern science. 

When Galileo was having his troubles with the Inquisition over his support of the Copernican view of the solar system he felt impelled to quote an eminent ecclesiastic who opined that "the intention of the Holy Ghost is to teach us how one goes to heaven, not how heaven goes." It strikes me as a comment that has lost none of its cogency over the intervening centuries. 

---

[1] As quoted in Gillespie, Charles Darwin and the Problem of Creation (Chicago: University of Chicago Press, 1979), p. 68.

[2] “Christianity and Darwin's Revolution," in Ralph Buchsbaum, ed., A Book that Shook the World (Pittsburgh: University of Pittsburgh Press, 1959), p. 32.

[post_title] => Evolution and Creation: Two World Views [post_excerpt] => Dialogue 17.1 (Spring 1984): 44–50
The big question for me in this controversy is whether freedom of inquiry, with the agonizing ambiguity that accompanies it, will be sacrificed to the interests of those who demand certainty in the hope of salvation. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => evolution-and-creation-two-world-views [to_ping] => [pinged] => [post_modified] => 2024-01-28 16:19:53 [post_modified_gmt] => 2024-01-28 16:19:53 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=16174 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 16654 [post_author] => 3946 [post_date] => 2018-04-24 16:34:29 [post_date_gmt] => 2018-04-24 16:34:29 [post_content] =>

Nothing has so baffled and frustrated man as the problem of his origin. It is doubly troublesome because both science and theology feel impelled to solve it by offering two totally opposed solutions. Believers in Judaeo-Christian scriptures find an answer in the first two chapters of Genesis which they interpret as requiring a divine supernatural origin for the human family. Science has discovered another possibility in the form of the theory of organic evolution. The ordinary citizen, caught between two certified sources of truth, has trouble deciding what he can safely believe. 

Latter-day Saints are caught in the evolution anti-evolution conflict in much the same way as other Bible-based religions but to an intensified degree. The gospel plan of eternal progression is peculiarly body-oriented. Before birth the spirit is said to be unembodied; it is embodied at birth, disembodied at death and reembodied in resurrection. That every worthy spirit should receive a proper human body is a fundamental necessity so important that the possibility of its coming by chance or by accident, without divine provision, is unthinkable. 

In the minds of most church members, organic evolution leaves God out of the picture and reduces the body of man to the level of a lower animal. And yet, the arguments for evolution are so persuasive and voluminous that many waver in their opposition. In the face of conflicting evidence and in a state of painful indecision, many if not most members would welcome a decision from a credible authority wiser or better informed than they. Many, therefore, believe that such a decision actually exists and that it is set down in the statements of General Authorities. The impression is widespread that organic evolution has been officially condemned by the Church and that evolutionists are holding their views in opposition to duly constituted authority. 

THE CHURCH OF JESUS CHRIST OF LATTER-DAY SAINTS
47 EAST SOUTH TEMPLE STREET 
SALT LAKE CITY, UTAH 

DAVID O.McKAY, PRESIDENT

February 15, 1957 

Professor William Lee Stokes 
2970 South 15th East 
Salt Lake City, Utah 

Dear Brother Stokes; 

Your letter of February 11, 1957, has been received. 

On the subject of organic evolution the Church has officially taken no position. The book "Man, His Origin andDestiny" was not published by the Church, and is not approvedby the Church. 

The book contains expressions of the author's views for which he alone is responsible. 

Sincerely your brother, 
David O. McKay [Editor’s Note: Signed]
(President)

But is this so? 

In 1957 as Head of the Department of Geology at the University of Utah, a position once held by Apostle James E. Talmage, I became aware of the need to know the position of the Church on organic evolution. This feeling was intensified by the publication in 1954 of the book Man, His Origin and Destiny by Joseph Fielding Smith, then President of the Twelve Apostles and later to become President of the Church. I decided to make inquiry of President David O. McKay not only for my own personal satisfaction but on behalf of thousands of college students who are entitled to correct information. My letter to President McKay need not be reproduced. In essence I asked him if the Church had taken a position and if President Joseph Fielding Smith's book had the weight of an official pronouncement. I believe President McKay answered with the intention that his statements would be used by me in connection with my official duties as a teacher in a public institution but he did not specifically grant me permission to publish the letter. Rightly or wrongly I have forwarded copies to those interested enough to ask for them and these have been copied and recopied to give the letter fairly wide distribution. At no time did I personally broadcast the letter or give it wide publicity even though I think I would be justified in doing so. 

Antievolution sentiment continued to grow in the 1950s and was strengthened by further publications by General Authorities such as Doctrines of Salvation, a compilation of President Smith's writings by his son-in law, Elder Bruce R. McConkie, and by Elder McConkie's own book, Mormon Doctrine. In Mormon Doctrine (Salt Lake City, Bookcraft, Inc., 1958, p. 230) after quoting from President John Taylor (Mediation and Atonement, p. 160-161) Elder McConkie states: "This aptly expressed and plainly worded statement from President John Taylor summarizes the official doctrine of the Church as to the falsity of the theory of organic evolution."[1]

In the face of what appeared to me as a contradiction of authorities, or at least a serious difference of opinion, I continued to feel a need to publish the McKay letter but was restrained by the idea that I had no clear permission to do so. However, I acted at last, and on 13 October 1968 I again wrote to President McKay and asked for permission to publish the essential statements from his 1957 letter. At this time he was so ill (he would die 18 January 1970) that I scarcely expected a reply. However, on 18 October 19681 received a letter over the signature of Joseph Anderson, Secretary to the First Presidency, stating that he had been directed to tell me that there was no objection to my use of the quotation, "on the subject of organic evolution the Church has officially taken no position," in my book. 

Not until now have I published the McKay letter as I have made it the cornerstone of a manuscript I have written titled, "Can Latter-day Saints accept evolution?" This book has been rejected by all local publishers and may never see the light of day. That is another story. The letter is still timely and appropriate. Today may be an even better time to make it public than when it was first written. I therefore submit it for facsimile reproduction with the foregoing paragraphs as an introduction. 

In postscript let me say that I have been accused of forging this letter and of taking unfair advantage of President Smith. Let the readers judge. I am personally grateful that the Church has not been caught in the position of taking a stand that might very well prove to be wrong in the future. This has already happened to a number of fundamentalist churches among whose ranks I am happy not to be included. It is also faith promoting to me to know that God expects men and women to sift and study many subjects for the truth that is in them and that He does not solve all our problems by official pronouncements. 

---

[1] The second edition of Mormon Doctrine (1966), p. 248, while dropping the term "official," conveys virtually the same message: "This aptly expressed and plainly worded statement from President John Taylor expresses the same views and perspective found in the writings and sermons of Joseph Smith, Brigham Young, Orson Pratt, Parley P. Pratt, Charles W. Penrose, and many of our early day inspired writers." Nowhere is it suggested that a view such as that expressed by President McKay might also be held by inspired leaders. — Ed.

[post_title] => An Official Position [post_excerpt] => Dialogue 12.4 (Winter 1979): 90–92
In postscript let me say that I have been accused of forging this letter and of taking unfair advantage of President Smith. Let the readers judge. I am personally grateful that the Church has not been caught in the position of taking a stand that might very well prove to be wrong in the future [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => an-official-position [to_ping] => [pinged] => [post_modified] => 2024-01-28 18:36:18 [post_modified_gmt] => 2024-01-28 18:36:18 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=16654 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 17033 [post_author] => 2300 [post_date] => 2018-04-26 19:56:24 [post_date_gmt] => 2018-04-26 19:56:24 [post_content] =>

Duane E. Jeffrey's article in the Science and Religion issue of Dialogue, "Seers, Savants and Evolution: The Uncomfortable Interface," has provoked a good deal of response, a response that suggests that in some ways the interface is indeed uncomfortable. While some responses have been published in the "Letters to the Editor" section of the past two issues, we have reserved space here for three more substantial reactions to Jeffrey's article—by Stephen and Kathy Snow, Dow Woodward and Norman L. Eatough—and for Jeffrey's response to the issues they raise. Dialogue feels that such exchanges are part of the continual "sifting and winnowing" by which we can, along with other processes, find the truth. We welcome other readers to participate in the dialogue. 

Duane Jeffrey is to be thanked for his article, "Seers, Savants and Evolution: The Uncomfortable Interface." It is an excellent summary of the history of thought on evolution in the Church. To illustrate its power, it made us very carefully reconsider our own anti-evolution bias and again perceive evolution as a possibility. However, as he himself stated, "For statements on Church doctrine, we are traditionally referred to the four Standard Works," and it is perhaps unfortunate that he limited himself to official and semi-official statements of this dispensation and did not deal with certain of the scriptural references which are often used to refute evolution. We, for instance, would have loved to know how B. H. Roberts explained 2 Nephi 2:22-23 in defending pre-Adamites. We have yet to hear a convincing pro-evolution discussion which takes the scriptures into account instead of laying them aside until all the evidence is in. It is not until a scientist makes such a convincing case that those for whom the scriptures take precedence when conflicts arise will be persuaded. (Hopefully we will not have to wait for the publication of Roberts' treatise.) Until such time, members on either side of the controversy should be willing to accept the fact that those who believe in evolution can still be valiant members of the Church and that those who do not now believe in it are not intellectually blighted. 

After the sophisticated view of science in Richard F. Haglund Jr.'s "Science and Religion: A Symbiosis," Jeffrey's somewhat simplistic view of science was rather surprising. Compare Haglund's skepticism of scientific "truth": "In the final analysis, it is apparently the metaphysical incompleteness of physics which prevents the erection of a comprehensive, self-consistent model of the universe. And this should make us skeptical of claims for both comprehensiveness and logical consistency in any other science, because physics deals with the simplest models and has the most formal mathematical structure of all the sciences," with Jeffrey's "anyone who chooses to ignore the subject [of evolutionary processes] surely jeopardizes the development of an accurate view of the world around him." We would not advocate that one ignore evolution, but Jeffrey does seem to exhibit the tendency common among biologists to make science into Reality where physicists (as Haglund also demonstrates) have given up the attempt. 

It is true that some evolutionary processes do occur; no one has ever denied that to our knowledge. The question lies indeed in the extent to which they have operated in the history of the world. Evolutionists would have us believe that this admittedly well-documented and widely-accepted theory is the way things were. What is too often forgotten is that a theory inevitably determines the types of questions which are asked and therefore the kinds of evidence collected. As Thomas Kuhn puts it in The Structure of Scientific Revolutions: "Those [phenomena] that will not fit the box are often not seen at all." The First Presidency, as Jeffrey fully documents, has been more circumspect than either side in the present conflict in admitting evolution as one of the possibilities of creation. Perhaps we should not even discount Orson Pratt's literal reading of the scriptural accounts of special creation as lightly as has been customary. After all, if "cloning" (replication of an individual from a somatic cell) is now possible for men, why could God not perform some similar operation to produce Adam, then Eve from his rib (!) then breathing into them "the breath of life," the part scientists have not yet managed? 

This adds another mechanism to the three the First Presidency outlines: evolution, transplantation or procreation. Whichever of these was actually used, however, no one need settle on any single one of the four to see God working rationally through laws. Jeffrey cites the personal experience of many who found that belief in evolution can produce "a deepening of religious sentiment and spirituality due to the recognition that God is a God of law, of order, of rational behavior, rather than a diety of mystery, of transcendent and capricious whims." This has been one of the standard ploys of pro-evolutionists who accuse non believers of postulating a capricious or whimsical God. Any of these four mechanisms would be in perfect accord with law and be in no way arbitrary. In fact, we might do well to leave the door open for other possibilities. We cannot limit God to the laws we know. 

Wherever the Truth lies, Jeffrey's article is a start on the right path. He has finally laid aside the polemic which has characterized virtually all writing on evolution in the Church, although his bias is immediately clear and could be offensive to some. Perhaps we can finally sit down to a dialogue. 

STEPHEN & KATHY SNOW
Pfullendorf, West Germany 

---

I would like to make some observations about some of the comments made by participants in your special Science and Religion issue. Much of what was stated in the major article by Duane Jeffrey is reasonable and would be difficult to dispute; I enjoyed the article. However, it doesn't go far enough and it comes across as if he were an apologist for the Church. He speaks of the many religionists who have had opinions about science and religion without any knowledge of modern science; hence they develop arguments and provide insights that are based on limited information and are reminiscent of the polemics of Darwin's era. The question I am raising is why rationalize current knowledge and facts of genetics and evolution with either ancient scripture or what early leaders of the Church thought about the subject? It is obvious that neither group thought profoundly about the subject in terms of current knowledge. To take a scientific subject that is understood to a large degree on the basis of insights possible only in the last fifty years and compare it with statements of Joseph Smith, Brigham Young or the Bible on the same subject matter, treated in vague terms at best, seems patently absurd to me. There is no reason to believe that these men should have understood the biological nature of man. We can point to non-religionists of the same eras who made similarly vague but generally "in the right direction" statements on the subject. By the same token we can find many statements by Joseph Smith and Brigham Young on the subject of science biology—evolution—the nature of man—that on the basis of current knowledge are as misguided as the quoted comments appear to be perceptive. 

What ancient or modern religionists thought about science is a matter of historical and/or esthetic interest—yet the majority of the members of the Church use this as their sole source of information about science—biology—evolution. Having only conversed with Duane Jeffrey on one occasion, my guess is that his true feelings are grossly toned down, but regardless of how he thinks, my own feeling is that some of the "known" biology needs to be said much more forcefully and documented by data much more completely. 

After all, more has been learned about the biology of man in the last twenty years than in all the previous history of man. It is now known the form in which genetic information is stored and how it is dispensed. The mechanism of mutation is well understood as well as the way these molecular mechanisms are translated into the phenotypes we observe. The mechanism of genetic disease is understood and can be controlled in many cases. The technology of transmitting genes from one species to a different species is now possible—genetic engineering is no longer science fiction but a reality if man only knew an intelligent way to use it. The molecular mechanisms necessary to explain the process of evolution are known. How with all this detailed information can one be preoccupied with what anyone prior to 50 years ago said about the subject? How many times in the history of man will it be necessary to demonstrate that religionists have never had any meaningful insight into the biological nature of man and that whenever this has become blatantly obvious, some of them simply change their stance a little to compensate and promptly restate their authoritarian position as dogmatically as before, knowing once again, they presume, more than anyone else about the subject. ("Men never do evil so completely and cheerfully as when they do it from religious conviction," Pascal.) ("Some people are more sure of what they think than others are of what they know" Descarte.) Henry Eyring stated it well in his typically pleasant underplayed, low-keyed tone describing his conversation with Joseph Fielding Smith, "I have read your books and know your point of view and understand that is how it looks to you. It just looks a little different to me." 

In his discussion of "spirit" or vital force Jeffrey simply states the rather official position of the Church regarding that doctrine without any evaluation of that position. There are certainly valid logical grounds for criticism of the generally accepted position that all forms of life have a spirit in the same sense that man has a spirit. The doctrine on the one hand would have us believe that we are sons and daughters of God in a spiritual sense, i.e., our spirits are the spirit children of God and in that sense he is our Father. It would have us believe that having spirit children is a lofty position granted only to a small group who obtain exaltation in the Celestial Kingdom. All others including some very good people will not have the power of spiritual increase. These spirit children of God and his wife (?) we are led to believe are analogous to ourselves and our relationship to our mortal parents. Yet we are asked to believe that mosquitos have a spirit in the same sense—i.e., that God created it—or perhaps the closer analogy would be a mosquito God who creates it. If it is "our" God who created our spirits by "eternal increase" then does it not seem strange that our spiritual parents would be giving birth to mosquitos as well—not to mention rabbits, kangaroos and penguins? Does it not also seem strange that now that man can create life (defined by a self-replicating biological system) in a test tube or clone a frog from a single somatic cell or produce mutants artifically that do not morphologically resemble any already existing form of life—that these new creatures, that are to some degree man's handy work, would have or need "spirit"? Is there a ready made spirit waiting for any sort of theoretical organism that man chooses to produce by mutational or genetic manipulations? 

Perhaps spirit means what Brigham Young speaks of when he says the earth has a spirit—a spiritual creation. This can be interpreted to mean that the spiritual creation represents God's preknowledge of existence rather than that a tangible spirit substance exists. But now I fall into the trap of trying to explain statements that may have no meaning at all in the context of current knowledge. If I create a self replicating virus by enzymatic or organic synthesis of the DNA, my knowledge of the properties and behavior of that DNA in the environment of a host cell—i.e., that it will replicate and produce many new viruses from it—does not suggest in any way the need for spiritual substance to sustain that replicative biological system. So what I am really saying is that if Brigham Young had nothing terribly perceptive (compared to modern knowledge) to say about evolution and biology as we now understand it, why would we expect him to know any more about the things we still don't understand? Simply because science has nothing yet to say? This is a deception that has been used for centuries—to speak authoritatively about the things that no one understands, implying that somehow God gave you insight that no one else has. If no one can prove you wrong, there is very little risk in dogmatic speculation. Translated into what happens in science itself, the subjects least well experimentally unraveled produce the most emotional dogmatic defenses. 

Although I have not understood the rationale behind the idea of interviews with anonymous scientists I would like to speak to a point or two from the comments of the biological scientist. He talks about God releasing or holding back information from us as if nothing we do has any influence on how much we know or can learn. He makes it sound almost as deleterious and sterile as our educational systems that brainwash us into thinking that we can't learn unless we take a class and have an authority figure lecture to us on the subject. But he goes on to explain that the reason God withheld information in earlier times was "that they couldn't handle it." Is he by any chance trying to tell us that we have since then learned how to handle it? We certainly know how to use it to wage war, to exploit and deplete the world's resources, to pollute the air and water, to use it to support theological arguments when it helps our cause and to discard it when it doesn't, or revert to Aristotelian science when we can't cope with the reality of what is known today. So when he says, "If we are not supposed to know how to do this, we are not going to learn it," I say, "I'm not surprised that you want to remain anonymous." It is hard for me to visualize what coping less would mean. We have overpopulated the planet—many starve, others suffer from overpopulation in other ways. We develop capitalistic enterprises based on the concept of greed rather than united order type enterprises in which loss of ownership leaves no place for greed. We develop class structure—elitism—in which a privileged few enjoy the bulk of the resources at the expense of those who are exploited. The people within the Church do everything possible to chase away anyone who learns to think independently and only an occasional Henry Eyring type is able to stay with it, presumably because he has enough self-confidence and understanding of the authoritarian regimentation toward conformity that he can say, "Isn't it interesting that we think and interpret differently?" and is not threatened by it. If God will allow us to get ourselves in the mess we find ourselves in today, why would he want to stop us from learning anything we are capable of learning? 

My major point is that in so much discussion about the subject science and religion, why is there such a paucity of science—and the little bit that is mentioned is ancient history? 

If the readers of Dialogue really want to understand the interface between biology and religion, they ought to be exposed to the realities of some of the relevant biology (I'm assuming that they know most of the relevant religion). For example, to trace the evolution of the structure of a protein such as cytochrome c or hemoglobin gives a perspective about the process of evolution, as well as the reality of it that can never be approached by trite polemics and quotations from men who didn't know the difference between a protein and a jellyfish. Is the idea of Dialogue participants to really lay it out and see it as it is or to continue to be apologists for the Church as well as for past Church leaders? 

Dow Woodward
Stanford, California

---

One of my pet peeves in the Church is the incessant willingness of some Mormons to change facts and adulterate history to serve current beliefs and practices. It is most distressing to see a competent scientist like Duane Jeffrey adopt these tactics. His willingness to compromise Church history to reach a conclusion that the Church has not taken a stand against his pet scientific dogma has an all too familiar tone. Readers of Dialogue were entitled to more than a selected rehash of quotes on creation and evolution to reach the dubious conclusion that no stand has been taken. 

Jeffrey follows familiar biological orthodoxy in affirming his belief in evolution by natural selection based on a few isolated "proofs." The tiresome ploy of equating obvious and uncontested changes within "kinds" to "affirmative resolution" of the generalized theory of evolution by natural selection has been used for years. Evolution involves an increase in information content of DNA, but natural selection involves only the elimination of error or modification of information. 

Evolutionists are still arguing the merits of natural selection versus genetic drift or random walk mechanisms. Biomolecular evolution is still speculation but it necessarily forms the "genesis" of evolution by natural selection. It is misleading to imply that evolution by natural selection has "long since been resolved affirmatively." "The truth/' said Aristotle, "is like a barn door—nobody who throws at it can miss it entirely, but nobody can hit it all at once." 

Mormonism is unique among religions in its head-on collision with the theory of evolution by natural selection. We cannot get off as easily as other religions by just reinterpreting or discarding Genesis 1 & 2. We also have modern revelation on the subject. After all, Joseph Smith revised Genesis and pronounced it correct without changing the creation account. He repeated the same account in Abraham, in Moses, and in the temple ceremony. This story of the creation is basic to our Plan of Salvation and irreconcilable with the theory of evolution by natural selection. 

As with all Mormon apologists, Jeffrey has swept the basic questions under the rug in a deluge of half-truths and even admits selecting references which reinforce his thesis that there is no Church position on evolution. His display of circular reasoning is better than most. After quoting passages from nearly every Church president supporting the Genesis creation theory, including the 1909 official proclamation by President Smith and the 1925 reiteration by President Grant, he concludes the Church has taken no official position on evolution. When unable to support his conclusions with evidence he resorts to the unprofessional presentation of secret sources which cannot be revealed (reference 54). 

Why are we afraid to attack the real issues? I saw no attempt to deal with the problem of fitting the spiritual creation into the evolutionary sequence. Did spirits evolve like flesh according to natural selection? Did spiritual evolution take place before or contemporary with mortal life? Was the spiritual creation engineered according to the natural selection needs of a telestial environment? Or, are we to discard the concept of the spiritual creation along with Genesis 1 & 2? 

Joseph Smith said, "We believe that men will be punished for their own sins, and not for Adam's transgression." The Plan of Salvation is built around the concept of the Fall. Lehi and Alma teach there was no death before the fall, but evolution by natural selection is based on a long history of life and death before the first man. According to Brigham Young the fall of Adam and the process of death are intimately mingled. Evolution by natural selection would have us reinterpret the Fall, but without the Fall, as Joseph Fielding Smith points out, the atonement was unnecessary; so the missions of Adam and Christ are inseparable. If there was no fall there was no need for an atonement and therefore no need for Christ—and where does that leave Christianity? If evolution as Jeffrey describes it is real, there is need for a drastic reinterpretation of the Plan of Salvation as we now know it. Basic principles of the gospel and evolution by natural selection are incompatible. It is misleading to infer otherwise as Jeffrey does. 

The evolutionistic reinterpretation of Genesis 1 & 2 might be acceptable if that were the only record. However, when the same account is repeated in the modern scriptures of Moses and Abraham, upheld by the Doctrine and Covenants and the temple ceremony with literal interpretations supported by every President of the Church—to say no stand has been taken is incorrect. To imply that God used the process of evolution by natural selection as His method of creation without considering the implications is superficial. This makes God a liar, taking credit for things He did not do. Man is left devoid of a divine origin, no longer the offspring of God. Scientists who think God started with a one-celled animal or a strand of DNA or amino acids and let it evolve by natural selection into a being of His likeness postulate natural selection with a predestined end product. This leaves probability out of the process and strikes at the very foundation of the theory. 

I read with amusement Jeffrey's statement, "We assert immediately that, among mortals, only the President of the Church can articulate a Church position—on anything." This has interesting implications since Brigham Young successfully "articulated" the position of Church president at a time when we had no president and no "articulation" should have been possible. Somewhat of a paradox I would say. I'll bet Sidney Rigdon and Joseph's sons would have been interested in Jeffrey's hypothesis. 

Let's take a closer look at what the Church presidents have said about the method of creation. In addition to the modern scriptural accounts reinforcing the Genesis story, Joseph Smith said, "For it is a decree of the Lord that every tree, plant and herb bearing seed should bring forth of its kind, and cannot come forth after any other law or principle"(DHC, 4:555). Jeffrey does not accept this as a position statement because the word "specie" is not used. Seems like biologists who cannot agree among themselves as to what constitutes a specie should be the last to criticize the use of "kind" by the uneducated before 1859. In 1860 Brigham Young took care of this objection when he stated, "Every species is true to its kind." Jeffrey still doesn't accept this as nonevolutionary, inferring Brigham is ambiguous in his meaning of "species," but reading the statement in context shows Young was emphatic in what he meant—species (JD, 8:30). 

John Taylor left no doubt about his position on evolution. In Mediation and Atonement, published while he was president, he stated, in a quote omitted from Jeffrey's article, "These principles do not change, as represented by evolutionists of the Darwinian school, but the primitive organisms of all living beings exist in the same form as when they first received their impress from their Maker. . . . It would be impossible to take the tissue of the lower, or, indeed, of any order of fishes, and make of them an ox, a bird, or a man ... " (p. 164). President Taylor goes on to warn against interpreting limited changes within the species to imply general evolution, totally refuting the argument Jeffrey is attempting to make. No wonder Jeffrey did not include this quote. It would be like saying the sun does not shine while looking at it to interpret this other than a decisive denunciation of Darwinian evolution.

Wilford Woodruff seems to be talking directly to Jeffrey when he states, "In fidelity prevails throughout the world; very few, either priests or people, believe in a literal fulfilment of the Bible. They have a theory, but as to believing in a real fulfilment of prophecy, or that the Lord meant what he said and said what he meant, that is out of the question—very few believe it" (Journal History, Jan. 1, 1871). Lorenzo Snow was the only Presidential advocate of evolution. His "As man is, God once was, and as God is, man may become" is certainly evolutionary, but it is a process of celestial selection not natural selection. 

Under the presidency of Joseph F. Smith the official proclamation of November 1909 was issued. The heart of the proclamation states, "It is held by some that Adam was not the first man upon this earth, and that the original human being was a development from lower orders of the animal creation. These, however, are the theories of men. The word of the Lord declares that Adam was 'the first man of all men' (Moses 1:34) and we are therefore duty bound to regard him as the primal parent of our race." Jeffrey wonders, "Did the article really constitute an authoritative pronouncement against evolution as a possibility for the origin of man's body?" In 1925 Heber J. Grant reiterated the 1909 proclamation (Era, 28:1090). 

The views of Joseph Fielding Smith should be enough to convince anyone that a president of the Church has articulated a position against evolution. His book Man, His Origin and Destiny contains over 500 pages dedicated to showing evolution as "the doctrine of the devil." In spite of Jeffrey's alleged controversy between Talmage and Smith over the book, David O. McKay certainly did not refute the work and it is well recognized that Smith stood his ground after becoming President. 

Even biologists agree repetition is the key to truth, but how often does revelation have to be repeated to be true? How many Church presidents have to condemn evolution before it becomes a Church position? There are none so blind as those who will not see. The Church position is unmistakable: evolution is not acceptable and the reasons have been stated. This position and the facts of evolution (not necessarily the theory of natural selection) are incompatible and irreconcilable. This is, indeed, a problem. Too bad Jeffrey was not willing to face it. Jeffrey's conclusion that "the critical message is not what method was used in creation, but that God was responsible for creation" shows a naive disregard for the serious implications of evolution for the validity of the Plan of Salvation. Apologists like Jeffrey who would sweep problems under the rug by asserting the Church has not spoken and pretend no problem exists only delay the inevitable results. We cannot remain like an ostrich with its head in the sand. The rift is too deep and basic to ignore. As Joseph Fielding Smith prophetically said, "There is a conflict existing between revealed truth coming from the Lord to his chosen servants and the false doctrines advocated by men of science. There is also a conflict between false religion and truth revealed through scientific investigation. The time will come when nothing will remain except truth" (Man, His Origin and Destiny, p.l). Science marches on, and if evolutionists can get their story together into a unified theory the truth will be obvious, but even then the Church will go on undisturbed. Mormons have shown they will believe what they want to believe regardless of the facts. 

Norman L. Eatough
San Luis Obispo, California

---

Duane E. Jeffrey responds 

It is at once evident, I think, that my article ("Seers, Savants, and Evolution . . . ," hereinafter "SSE") was introductory only; no attempt whatever was made at formal synthesis of evolution and religion. Nor will it be made for some time (at least by me; others have manuscripts already finished). First must come a staking-out of boundaries of inquiry, and those boundaries are far less fixed than what we have traditionally been led to believe. We will do well to explore them very closely before we venture further. This response, however, attempts primarily to outline some of the areas which must' eventually be traversed. 

I shall try to distill out the points raised in the three preceding letters, and respond to them under specific collective headings. Unfortunately, this format loses some individuality but seems unavoidably appropriate under the circumstances. 

Selection and Use of Source Materials. 

As charged by Mr. Eatough, I did indeed "select" my sources. My "selection" was to take everything I could find of a direct nature that came from members of the First Presidency. I pointed out ("SSE," pp. 42-43) the reasons therefor, which should be obvious. But of the authoritative First Presidency statements, it is Eatough, not I, who is "selecting." For example, Mr. Eatough elevates the 1909 statement (and his assessment thereof) to the status of eternal truth—choosing to ignore the 1910 editorial, the 1911 editorials, and the 1931 pronouncement. What do these mean, if he is correct? Further, he asserts that the 1925 statement by Heber J. Grant et al. reiterates that of 1909. As pointed out in my article (p.63) the Grant administration excerpted directly from the 1909 statement right up to Mr. Eatough's "heart of the proclamation"—and then conspicuously skipped it! Why, if his position is correct? Can Mr. Eatough give us a cogent, rational, and honorable explanation for all these actions and statements, if his hypothesis is correct? Rather, his interpretation would appear to make the brethren guilty of duplicity. I have proposed an interpretation that fits the available collection of data; Mr. Eatough's—though not extensively developed—finds consistency only by ignoring most of it, as has been done by others for years. Further, the historical review developed in the article indicates that Mormonism has maintained, albeit with difficulty, a position from which to develop the synthesis of truth so long given lip service. Mr. Eatough's position would stifle all that, and lead us directly into the 19th-century Christian traditions that have been known for decades to be so wanting and impotent. 

If, as charged, my article is a "rehash," can it be pointed out where any of the 1910-and-following items have been quoted or even acknowledged in any other general publication since their original expression? The pre-1910 materials may be a bit of a rehash (though they were for the first time put into historical context), but the remainder, the critical material, is a resurrection of information long ignored or slighted. 

Scriptural Analysis and Prophetic Commentary. 

The Snows, in asking for a more thorough discussion of scripture, and Eatough in criticizing me for not affirming a literal interpretation thereof, hit upon topics of critical importance. Especially so because most aspects thereof are badly (and often deliberately) abused in our general Church communication. I speak of two tightly interwoven subjects; scriptural interpretation, and reliability and interpretation of discourse by latter-day prophets. 

I think any honest person must admit that the creation scriptures, and many others, have to be "interpreted"; their literal reading does not even begin to tell a coherent and internally consistent story. I do not set myself up as an assertive and definitive interpreter of scripture, and a review of the interpretations offered by LDS authorities over the years would be far too voluminous for an article like either "SSE" or this present discussion. For example, one should try sometime to distill from our prophetic commentary which scriptures refer to a physical creation and which to a spiritual. 

The problem here is a two-fold one. First, zeal in preaching has produced a tendency to leap too quickly in scriptural interpretations, to define them too tightly and defend them too hotly. Secondly, there exists throughout the Church structure, from persons in high and low authority (and from authors and spokesmen, with no particular authority), a teaching to the effect that "the brethern never err," certainly not on anything "of significance." Over the years, this tendency and doctrine have cost us dearly; the doctrine is totally unsustainable. On all of the above issues (and many others), no matter which interpretation one may accept, one is forced to reject at least some teachings of some prophets. The pain in that process stems purely from the erroneous doctrine of prophetic infallibility. Even Joseph Smith, whom we traditionally view as closest of all in his intimacy with God, openly rejected the idea. Others of his successors have done likewise (cf. "SSE," fn. 6). We must internalize the validity of that rejection; the doctrine of prophetic infallibility is foreign to Mormonism. 

Quoting general authorities, then, on either their own statements or on specific interpretations of scripture, is by itself not fully meaningful unless carefully placed in the context of their specific times, concerns, and experiences, and with all other available related statements and data for the time. 

Further, as students of critical gospel subjects, we must become better versed on the processes by which such interpretations are made and how they become ingrained in our "theology." The Snows are correct in pointing out that a simplistic view of science will not be successful, and I think they will agree that an overly simplistic view of religion is equally dangerous. In-depth studies of all the above passages and topics (and others) are needed. Only when such studies are made and the findings recognized can we move with legitimacy to the more derived issues. Such analyses will take courage; our literature both published and otherwise is sprinkled with unfortunate incidents regarding persons who tried to call our attention to such problems. Consequently, most attempts lie mouldering on university thesis shelves or in private filing cabinets. But the studies must be made and publicized, for until we can honestly face our past, we cannot hone our tools with which to effectually face the challenge of our future. 

I hope it is obvious that I am not suggesting that we disregard either scripture or prophetic commentary—I am instead pleading for incisive, analytical, and in-depth study thereof, for only thereby can the really legitimate material be identified and applied. But let us discontinue the practice of doing injustice and dishonor by forcing such sources to sustain meanings beyond their capacity; their vitality and message must not be further compromised by the exploitative treatment they have so often suffered. And, to acknowledge the direct question, I shall have to delay an answer as to how B. H. Roberts used II Nephi 2:22-23. I reiterate (as in "SSE," fn. 86), that one must not infer that Roberts' text is an argument for organic evolution per se; the situation is far more complex than that. I must here suffice with the observation that formal arrangements were made some time ago, with other authors, for a fitting announcement of the Roberts' manuscript to the Church proper; it will be available for qualified study. 

A "Church Stand" on Evolution. 

Mr. Eatough asserts that I reach a "dubious conclusion" that the Church has no stand on evolution. I am faulted for the "unprofessional presentation of secret sources." It may be that Mr. Eatough is trying to "smoke out" such references, and I would not blame him at all if this is the case. I sincerely, almost despairingly, wish that they could be made public, but I am under obligation to say no more than I have said on that particular point. No professional who has ever done in-depth research in Mormonism will need any further explanation; my dilemma is an all too-common one. Accepting such is just part of the price of research in many fields. 

The charge applies most strongly to fn. 54 in "SSE." The same problem concerns fn. 95. Here, however, the situation is a bit less sensitive and I shall—albeit hesitantly—attempt to partly indulge Mr. Eatough's curiosity. Fn. 95, and the words in quotes regarding it in the text, p. 67, should have been ample warning that I am not just bluffing, I can support my "dubious conclusion." I refer first to documents from the administration of President McKay, during which Joseph Fielding Smith's book Man, His Origin and Destiny was published, and the entire question of science and religion came to its highest recent head. (There are enough of these responses, amazingly alike and often even verbatim in many critical phrases and paragraphs, that no individual person need conclude that he can identify any particular statement as being uniquely from his letter, etc. I am concerned lest erroneous identifications be made.) 

First, from an interview conducted with President McKay by persons meticulous for detail, and recorded immediately afterward, quoting the President: "We do not know enough of the facts to take a definite position on evolution, but the concept is certainly not incompatible with faith. After all, the process of creation is going on continuously." Again, regarding Man His Origin and Destiny, "President McKay said that the book has not been approved by the Church; we are authorized to quote him on that. The work represents the opinions of one man on the Scriptures. Brother Smith's views have long been known. Striking the desk for emphasis, President McKay repeated that the book is not the authoritative position of the Church." From letters asking precisely if Brother Smith's book represented a Church view or position: ".. . this book [Man . . .] is not an approved publication of the Church. The author alone is responsible for the theories therein expressed." Again, ".. . the book . . . [Man . . .] expresses the views of the author, for which he assumes full responsibility. The book was not published, approved, or authorized by the Church. . . ." 

On occasion the inquirer was sent the 1909 statement as representing ".. . the position of the Church upon the subject of the origin of man" but specifically warned that ".. . the Church has made no official statement on the subject of evolution," thus evidencing recognition of a clean distinction between the two subjects which is often lost. The responses repeatedly avowed that the Church has not taken a position, and often the 1931 Talmage paper, as published by the Church, was included. These statements, together with the First Presidency editorials and materials discussed in "SSE," make it clear that no official position exists. 

Let me not be misunderstood. The letters do not promulgate evolution. They point out that revelation is the ultimate source of truth, though openly averring that revelation has not given answer to the issue (see the 1910 editorial, "SSE," p. 61, among others, for an early expression of that same concept, and from the same administration, Joseph F. Smith's, which Mr. Eatough claims had previously and unequivocally settled the matter). The letters (and other data) indicate that the entire subject of evolution is unresolved; that it is a subject of continuing modification in academic circles; that it is not feasible for the First Presidency to make public statements which would be applicable to future developments as well as current positions (a point that directly relates to our earlier remarks about keeping things in their historical context); that until either revelation or science can resolve the problem with absoluteness no statement will be made, and that conflicts should be dealt with by "suspending judgment" for as long as necessary until the complete truth is obtained. If my conclusion is indeed dubious, I'm afraid it must be argued with a President of the Church, not with me. Nor is President McKay alone; similar responses on the evolution issue were made by succeeding administrations. But I have given enough already to make the point. The record reveals that the problem is an uncomfortable one; it is also unresolved. 

Incidentally, while on the subject of Man His Origin and Destiny, my article nowhere even intimates, as I am charged, of a Talmage-Smith controversy over the book. Indeed, p. 65 clearly states that the book was not even written until after Talmage's death. If the sentence somehow refers to the Roberts/Smith altercation which occurred before the book was ever written, how can that be said to apply to the book, or called "alleged," since one has to ignore (among many other available documents) a seven-page statement by the First Presidency on the matter! 

Evolution and the Atonement. 

Mr. Eatough represents that evolution (he does not qualify it; it appears that he means any form of it, fully-theistic or otherwise) negates the atonement. I have heard this assertion many times over the years; but for the first time I can now openly query the writer: why? Please reflect very carefully on what the atonement is and does, and then tell me why. But I serve warning in advance: the usual arguments given in LDS literature are not firmly based. Be very very careful of your steps; that originally solid-looking footing turns rapidly to a morass of quicksand. 

"Fixity" of Species. 

I must confess to a certain admiration for Mr. Eatough's bravery in being so sure just what evolution is, what biologists agree on, what conclusions necessarily follow from specific propositions, etc. Especially is he brave since he is venturing well beyond his expertise, a point unmistakably flagged for everyone by his consistent use of the word "specie." Whatever the term may mean elsewhere, it has no position whatever in the vocabulary of biology, where it serves only to trip up those who are speaking without really having done their homework. The biological term is species, both singular and plural, and even Brigham Young used it correctly, though Mr. Eatough did not copy his quote thereon accurately enough to show that. And while we're on the subject, can anyone really explain, in meaningful biological terms, just what the Brigham Young quote does mean? Is it "species true to species," or "species true to kind, i.e., family or order or something at that general level?" The differences are profound. 

Mr. Eatough apparently insists on a fixity of species, and cites John Taylor to forever resolve the question. In his haste to demonstrate his own respect for President Taylor, Eatough seems not to realize that it is out of similar respect that I did not play that quote more heavily than I did. For, despite Eatough's implications, I did recognize Pres. Taylor's position as articulated in Mediation and Atonement (cf. "SSE," p. 58), and gave a more complete reference to it than Eatough does ("SSE," fn. 61)—but why set the President up just to knock him down? ("SSE", fn. 6 again.) The fact is that species do change, and it is not a question that is dependent on what any particular person says about it. As President Taylor put it in the excellent quotes with which "SSE" closes, let us "probe things to the bottom"; I am sure he would glory in the exercise. 

Species change. Even most of the ardent modern anti-evolutionists admit that fact. Indeed, some of them now go so far as to claim that they have been insisting so all along! It is a very popular argument of current anti-evolutionary Christian writers to acknowledge that species change, "but that is not really evolution"! We shan't debate that point here; the present question being forced upon me is simply: do species change? As stated, the answer is yes! There are hundreds or even thousands of examples, which are convincing by their sheer mass even if one is not quite convinced in individual cases (the time-factor associated with the necessary observations in nature complicates some cases). There are many cases that are unequivocal, and obviously only one is necessary to establish the point. The simplest (though by no means the only) demonstration probably rests with allopolyploidy. This is a system whereby very rare and sterile hybrids between two different species (or even genera) undergo a doubling of chromosome number which gives them total fertility with themselves but sterility with the original parents, and often very different form etc., therefrom as well. This process is a common one both in the laboratory and in nature—many examples are known. And when one finds two putative parent species in nature with an apparent derived polyploid species, takes the proposed parental ones into the greenhouse, artificially induces a polyploid hybrid which is indistinguishable from, and totally fertile with the putative derived species in nature (thus duplicating a natural process), one has got something more than just a hunch that the process works! Are these really species, reliably? Yes they are; I know of no person well-versed in the phenomenon who would even think of arguing otherwise, not even anti-evolutionist geneticists. 

A classic exercise in this regard is to take any non-circular definition of species one can contrive, which can be practicably applied to living things—and one will find numerous examples that transgress the definitions. By any testable definition ever proposed, species are observed to change! (The one definition whose challenge cannot be breached, of course, is the circular one: a species is that bounded unit in biology whose limits cannot change or be transcended. Some readers may wish to pursue that one; it has interesting implications). An example of polyploidy, before we leave it? The first one done artificially, though not necessarily the best, is Raphanobrassica, a species produced from a forced hybrid between radish and cabbage. It has been with us now since 1928, and there are myriads more known; evidence indicates that over one-third of the flowering plants and more than two thirds of the grasses are polyploids, even polyploids of polyploids! Readers who wish to pursue such subjects further should consult Chromosomal Evolution in Higher Plants, by G. L. Stebbins (1971), or Animal Cytology and Evolution, by M. J. D. White (1973), though many other fine documentaries exist as well. 

Species do change. That question has been "affirmatively resolved"—and that is all for which I claimed affirmative resolution. Please re-read p. 41 of my article; it can hardly be more clear. The significance of species change for the rest of evolutionary thought can still be discussed, but the fact is that species change is demonstrated. Being demonstrable, we should accept the demonstration "with joy" (First Presidency). Being the active intellect that he was, I suspect that John Taylor would rejoice in it. 

Adaptation, Design, and Attributes of Nature's Creative Deity.

The Snows make a critical point in relation to my comments regarding capriciousness in the characteristics sometimes attributed to Diety. I did not mean to use this as a "ploy"; I am sorry if the statement lends itself to that interpretation. But I do mean, definitely, what I said. I speak, of course, from the backgrounds within which I have studied and teach. Unfortunately (and here I must gently correct the Snows) there are people, and they are not at all rare, who do deny that any form of evolutionary processes occur, who sincerely feel that if they admit the validity of even one tiny piece of evolutionary biology, they will have permitted into their religious values the tip of a wedge which cannot be stopped and which they view with near horror. (We have Church writings which bolster that belief!) Every semester I meet a number of students who are very uncomfortable with the development of pesticide resistance in mosquitoes, warfarin resistance in rats, etc. Though some person will assert that these incontrovertible developments via mutation and selection have nothing at all to do with real evolution, still these trivialities cause considerable discomfort to many of our people. It is a deeply sincere position. And what do such persons offer as an alternative to explain the incredible adaptation visible in nature? Design—pure, thorough, and simple. As before, I make no attempt to pursue that question in depth (cf. "SSE," p. 44, and fn. 10). The Snows appear cognizant of the limitations of the position, and specifically circumvent it; from their point of reference the word "capricious" is quite probably inapplicable. But I doubt that theirs is the prevailing belief in the Church; even our current Family Home Evening manual comes dangerously close to falling into the trap. For trap it is, and an old one. Indeed, it was right on this issue that Darwin the clergy candidate got his start on wondering about species—and, interestingly, his response provides an excellent case-example of the very kind of thing Brigham Young was extolling (in his quote, p. 49, fn. 36, "SSE"). Under those intense concepts of design, capriciousness is really a very mild word, even an understatement. Sociology and history, for starters, readily establish the point, without even beginning to invoke the detail of biology. It is the posit of intense design that bestows such problems, of course, and it was to that that my remarks were directed. I infer that the Snows find capriciousness in God to be intensely repugnant; I share their disdain. It seems time, then, that we eschew those peripheral doctrines which inescapably confer it on Him. Nature's adhering to a design by a benevolent being may well exist, but the concept seems to be not defensible on the level at which it is so often claimed. 

Summary Response to Eatough. 

Eatough's proposals have further errors which cannot be left unrecognized. It is not true, for example, that "evolution involves an increase in the information content of DNA," at least not in the sense of his generalization. Among other examples, the whole world of parasites demands that we do better than this. The comments on natural selection and mutation are completely incorrect. Even if one chooses doggedly to ignore the ponderous demonstrations that mutation can produce new genetic information, and that natural selection can select affimatively for it, from the realm of genetic response by organisms to man's ever changing pesticides, antibiotics, etc., one cannot ignore the recent experiments which have localized and studied the chemistry of the gene mutations, the altered protein product produced thereby, and the brand-new chemical (informational) capability conferred as a result, and for which affirmative selection is observed. (This is still consonant with my earlier comments on information increase.) Mutation can produce new information, both in quality and in quantity; nature can select for it, and does. (The above examples are not cited as examples of species change; that question has been independently resolved.) The prospects of genetic engineering about which Eatough expresses interest are all part and parcel of one integrated bag of genetic tricks whose prospects are beginning to frighten even Nobel Laureate scientists—the imminent genetic revolution is just now beginning to sizzle—and the whole demonstrable bag runs directly counter to Eatough's assertions. 

Eatough could not be more correct that the implications of this entire discussion run very deep, far beyond the subject itself. It is precisely that which makes it all so critical; we indeed cannot afford to keep our heads in the sand. Open discussion must be developed. In the first footnote of my article, referring to the first use of the word in the text, I indicated clearly what definition I was putting on the word "evolution." Rather than taking note of that, and of the evident and plentiful contraindications throughout the article, Eatough seems to feel that if I show any sensitivity at all to any form of evolution, I am thereby a fellow-traveller with, and a brazen champion of, the extreme anti-religious element, that I am demanding total and unconditional religious capitulation. That is his inference, not my implication, and totally contrary to the entire message of my article. Contrary to his assertion, I did not spell out any specific view of evolution in the entire article; other reviewers have rightly noted that point. I am a biologist, yes; a geneticist, yes, and I have access to all the flexibility of data interpretation that exists in those fields, but in this •arena I am not bound by many of their limitations. The game we are playing in this search for truth is one of synthesis, not one contrived of extreme religionists on one hand and extreme anti-religionists on the other, each shouting epithets but never listening. 

I deeply hope that Eatough and others will participate in this dialogue, for there is much that needs to be aired, and he has yet available to him a good many avenues which can be pursued for profitable discussion. But let us get honestly down to 

Reliability. 

The Snows, in their short, insightful, and sensitive letter make one further point, which relates directly to Dr. Woodward's remarks as well. This has to do with "sophistication" in science, and indeed in all other mental and spiritual activity as well. What, really, is the "level of reliability" for both mental judgments and for action? 

I am not unaware of the lack of deep comprehensiveness and all-encompassing consistency in biology. Those who think it is all "cut-and dried" should address themselves to C. H. Waddington's series Towards a Theoretical Biology, among others. This deals only with the formal data of biology; there is more as well. The Snows quote Kuhn on items that "will not fit the box." Among a spectrum of other such commentators, Fort referred to such things as "the damned," "those things which science has forgotton." And one indeed finds them, ranging all the way from the really solid and currently inexplicable observations through items of progressively lesser documentation to those of sheer fantasy. We must be careful to distinguish, however, between observations that merely do not "fit" and those which are genuinely of sufficient weight and merit to force an overthrow of complete scientific positions. I know of none regarding the fundamentals of biology that have such weight, and I do make it a point to keep current on literature that claims such. 

And how does one work the mass of available data and claims down into one nice wieldy package? Not by dogmatism, from either science or religion—there is far more here than any version of either position can meaningfully explain. But that of course does not excuse us from the attempt, even though it does serve notice that we had better recheck our fundamentals and widen our sights. For religion too (and that includes, perhaps particularly, Mormonism) has rendered itself able to ask only certain kinds of questions, and look at only restricted kinds of data. Indeed, we have a whole coterie of commentators in the Church today who spend their time redefining theological words so that they need not look for any unwanted data. Note that, next time you encounter a labored explanation of the meaning of faith, or truth, or knowledge, or gathering, or any number of others. I think I needn't give specific references to such; they are evident enough in our popular literature once one is alerted to the problem. 

It seems clear, however, that the Snows fall into a category error in expecting that my comments regarding biology should subscribe in all points to the sophistication they see in Haglund. Sophistication in science can be both legitimate and blatantly otherwise. For one thing, I am not aware (though I have seen at least some of the arguments) that anyone has independently demonstrated that "formal mathematical structure" is the touchstone by which one must measure "reality." But beyond that: sophistication in discussing, say, the nature of light or matter is eminently appropriate; I confess to being less impressed with those who carry such sophistication to the questions of whether there is light or matter. Most people, it seems to me, just ignore the sophistication on such subjects and use light and matter to their benefit. I ask no more than that. For there are things in evolutionary biology which are just as straightforward as one's seeing light or perceiving matter, and it is these which underlie Woodward's response. Trying to avoid them by ultra sophistication is to divorce oneself from the ability to do anything worthwhile or useful at all. I am saying, then, that though there are indeed areas of biology wherein high sophistication is appropriate, there are others (other categories) in which it is a travesty. 

A type of category error appears to crop up again, in the Snows' letter, in the postulation of four possible mechanisms for the origin of man — they add cloning to the three indicated in the 1910 editorial. (Cloning, so far as I am aware, was first proposed in this vein in LDS literature by Frank Salisbury, in his Truth By Reason and by Revelation, 1965). Any of these four mechanisms would be perfectly in ac cord with law, the Snows affirm—and indicate that any of these would satisfy "God working rationally through laws." That, of course, depends totally on definitions— however subjective the term "rationally" may be, it certainly cannot be rigorously applied to laws beyond what we know. When we make that kind of leap for the actions of God, He becomes rational or suprarational (not irrational!). And, lest there be further misunderstanding of the term, my comments quoted by the Snows as to God evincing "rational behavior" must be understood in the latter sense; while I would not begin to claim that we can understand all of God's direct actions— indeed I assert that we cannot even identify them all—I do maintain that it is folly to characterize Him in such a way that He becomes duplicitous and/or irrational. And that is precisely what he becomes with virtually all of the anti-evolution arguments with which I am familiar. For, invoking a critical point not heavily made by the Snows, whatever method "God used" must eventually square with all the "factual" data (and here again we needn't burden ourselves with excess sophistication—let us keep such where it is appropriate). And when we adopt such a test (comprehensiveness of explanation, etc.) the superiority (n.b., I do not say "absolute truth/') of hypotheses which propose that some form of theistic evolution was involved becomes quickly apparent; the others, so far as I have observed, place God in an untenable position. For example, it seems to me quite reliable to "believe" that fossils exist. Their interpretation may well merit discussion; it seems to me that their legitimacy as remnants of previously-living organisms really does not. Evolutionary biology, of course, makes an attempt—a very good one—to explain them. Among others, one prominent anti-evolutionary commentator of high LDS rank had another explanation: "Well, of course we know that Satan just put those things there to deceive us." I cannot but wonder if persons who postulate this idea fully realize how widespread fossils are. They are found through and through virtually every major landmass known—if Satan really made all that, who then is the Creator of the earth? If nature indeed testifies of diety (a long-standing and still-in-vogue theological injunction), of which "diety" does it thus testify? And what is its testimony? For if the hypothesis be accepted, then God is a party to this by allowing such a monumental hoax, and indeed we have conferred on Him duplicity of truly staggering proportions! A witness of that sort, it appears to me, God can well do without. 

The above is not an extreme example; only an illustrative one susceptible to rather ready analysis. While I doubt the Snows would invoke it, I have met many LDS who do. Other proposals run into similar problems, and it requires far more than just sophistication to countenance them. Of the proposed four basic types of mechanisms for the origin of man's physical body, I think that a "rational" and comprehensive analysis will leave no question that, for sheer superiority of data explanation, proposals which encompass some form of evolutionary mechanism are far ahead of their competitors. 

There is another consideration that seems to bear on the entire issue of how much—and at what levels—sophistication is appropriate in the whole broad field of evolutionary biology and its associated disciplines. Though the historical heat and perpetualness of the subject indicates otherwise, there are those who insist that, after all the discussion is over, the "evolution debate" is all a matter of academic interest only—that it makes no difference at all at which point on the spectrum of belief one casts his personal vote. I think that a moment's reflection will indicate that the matter is far more important than that. Among numerous possible justifications, one in particular seems especially critical. At the risk of appearing in the guise of a crusader rather than a dispassionate academic, let me address a relationship that many readers will not have seen, and which some may even wish to see defended. It is referred to by Woodward, and centers around the fact that our world is faced with many deep problems, not the least of which are a host of biological ones. We need not go beyond those of food-production; including wildlife as a food resource, exploitation of the sea, agribusiness, breeding of new food strains and species, control or managment of predators and insects, population curves of both man and his food-species, etc. It should be conceded by all but the willfully refractory that we must come to grips with the biology of these problems; indeed it is thought by some to be already too late to stave off human suffering on a scale not before seen. And therein, to me, is the tragedy. In the face of such impending suffering, and such opportunity for service, too many of our people turn a deaf ear, offering such glib statements as, "We can always grow more; it is just a matter of more fertilizer," or, "There is enough and some to spare" pure and simple, or, "We don't need to concern ourselves about such things; Christ and the millennium will be here tomorrow and take care of all those people." We seem to have lost sight of President Lee's exhortation on that latter score, echoing President Woodruff: "The millennium may indeed come tomorrow, but I am still planting cherry trees." And what has all this to do with the evolution discussion? Put simply and bluntly: the mechanisms which must be used to resolve the food problems, etc., are the very ones at the heart of the matter regarding evolution, and many of our people willful ly insist that they do not exist. Only those mechanisms give us the tools we need for management of our practical (temporal, as separate from spiritual) response to those challenges. Our wheats (and indeed much of the rest of our grocery list) are polyploids, both the ones we currently use and many of the new ones with which we are experimenting. Their productivity and nutritional values have been enhanced by the production of new mutations, and careful selecting therefor. We could not begin to feed the number of people we do with the wheat used by the Egyptians, for example. Nor can we feed the world tomorrow without further diligent application of those same principles. One may argue "evolution" all day, but we cannot afford to flout the evolutionary mechanisms which we do "know" (I shan't get into the etymology of that word). As indicated earlier, however much physicists and others may discuss uncertainty, predictability, etc.,—or even the precise nature of light, few persons really argue whether light exists, they just use it. And on precisely that same level, we must recognize the validity of, and necessity for, the management philosophy and expertise that comes from what some call "evolutionary biology"; to enumerate, that mutation as a phenomenon does exist and produce legitimate and valuable new genetic information, that population size and structure in biological organisms do have consequences, that selection is an operative principle of importance, both domestically and in nature, etc. 

Some may feel this equation needs further discussion. I am perfectly willing to do that, but I would hope that such discussion will not impede our addressing the more serious and immediate aspects thereof. We have already been negligent as a people, to our discredit, for too long. 

The Snows, of course, do not fit into the category I have just described. I have merely used their very legitimate query as the springboard to point up some of the real immediacy of the entire discussion; it is not a matter of mere academics or neatness of doctrine. I thoroughly anticipate that there will be those who will score me deeply for making the equation I have; who will accuse me of cheap sloganeering, throwing up straw-men, alarmism, etc. I am confident that the validity of my associations can be amply sustained. But regardless of the present resolution of that point, I am more than willing to place final judgment thereon on our grandchildren. We certainly will need to wait no longer than that. 

In the meantime, one would hope for increased study and discussion of the many questions evoked in these exchanges. Virtually all our modern problems seem to re quire resolutions that invoke both technological (scientific, if you will) and "moral" (religious, etc.) responses. The bases for such response must be clearly identified and firmly grounded. It is high time we get to work.

[post_title] => Seers, Savants and Evolution: A Continuing Dialogue [post_excerpt] => Dialogue 9.3 (1974): 21–37
Duane Jeffrey is to be thanked for his article, “Seers, Savants and Evolution: The Uncomfortable Interface.” It is an excellent summary of the history of thought on evolution in the Church. To illustrate its power, it made us very carefully reconsider our own anti-evolution bias and again perceive evolution as a possibility. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => seers-savants-and-evolution-a-continuing-dialogue-5 [to_ping] => [pinged] => [post_modified] => 2024-01-15 21:17:16 [post_modified_gmt] => 2024-01-15 21:17:16 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=17033 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 17130 [post_author] => 1678 [post_date] => 2018-04-27 02:38:48 [post_date_gmt] => 2018-04-27 02:38:48 [post_content] =>

Nature and Nature's laws lay hid in night. 
God said, Let Newton be! and all was light. 

Alexander Pope 

The divergence of science and religion is essentially a modern phenomenon. Until the 18th century, theology was considered the queen of the sciences and scientists considered that their discoveries allowed them "to think God's thoughts after Him." Then increasingly sophisticated scientific methods led to discoveries that were in conflict with religion, creating a rent that until this day has not been mended. 

Western religion, increasingly narrowed and dogmatized through the centuries, did to science what it had done to everything else that threatened its power and position—called it demonic and tried to cast it out. But science was one demon that would not stay exorcised, and once free from religion it grew in power and pride until it became a religion itself, a status it enjoys in much of contemporary society. Science wields nearly as much power today as the church did during the Middle Ages. And it has misused that power at times as much as the church mis used its power. The devotion of science to the military in our day rivals the devotion of the Christian Crusaders to the idea of the Holy Grail—and with results that are equally devastating. As Richard Eberhardt says, modern man "can kill as Cain could, but with multitudinous will,/no further advanced than in his ancient furies." 

Today man's scientific knowledge and technical ability are expanding the frontiers of discovery in every aspect of life—from the black holes and exploding stars of outer space to the dark caves and bursting lights of inner space. And yet our existence on the earth hasn't been as perilous since the sea rose up to sweep away Noah's ark. Just as we are on the verge of creating a better world and exploring new worlds, we are destroying the world around us. As we explore the silent wilderness of space and the primal sounds of the psyche, we are wasting the precious wilderness of our lovely little planet. 

What we need is a new alliance between science and religion based on mutual trust and a recognition by each of the uniqueness of the other's contribution to man's life. When either science or religion acts as if it has exclusive rights in the domain of truth, it is a guarantee that truth will not be served. Scientists who play God, or priests who speak of God as if, in Thoreau's term, "they enjoy a monopoly on the subject," are not acting in God's or man's best interest. 

It is imperative that science and religion abandon their present peaceful but fragile co-existence in favor of a co-operative alliance. This need not happen by obscuring the differences between science and religion or in pretending that those differences do not exist. Although each offers different ways of pursuing and perceiving truth, they have more in common than most realize. For example, each requires faith, intuition and imagination to be truly effective. Recognizing their differences and building on their commonality science and religion can make a synthesis that centers on man and that serves man. It is only in such a cooperative venture that we can hope to survive our scientific knowledge. 

Latter-day Saints may have a unique contribution to make to a humanistic synthesis of science and religion. We believe that the Spirit of the Lord which was poured out in rich abundance beginning with the Renaissance and which culminated in the revelations of the Restoration heralded not only a renewal of man's spiritual hope but of his material hope as well—that the modern explosion of scientific and technologic knowledge is also an evidence of God's grace: He reveals both spiritual and material knowledge for our blessing. That Joseph Smith understood this well is seen not only in his declaration that spirit is nothing more than refined matter but in his famous observation that a religion which cannot save a people temporally cannot hope to save them spiritually. 

Mormonism's concept of God as an exalted man has profound implications, for if God was once a man as we are then he obviously progressed from partial scientific and religious knowledge to complete knowledge, just as we are promised we may: "He that keepeth his commandments receiveth truth and light, until he is glorified in truth and knoweth all things" (D & C 93 -.28); and, "He that receiveth my Father receiveth my Father's kingdom; therefore all that my Father hath shall be given unto him" (D & C 84:38). 

Thus, though we now understand neither the mysteries of light nor the mysteries of the atonement, we someday will—or at least can through our righteousness and the exercise of our intelligence. Through the epistemology of exaltation we will come to know all science and all religion and know they are one. To apply some lines from T. S. Eliot's "Little Gidding":

We shall not cease from exploration 
And the end of our exploring 
Will be to arrive where we started 
And know the place for the first time. . . 

Mormonism's understanding of man as a potential god who through his free agency can progress eternally can also help in the unification of science and religion. Such a concept focuses on man as a co-creator with God, one who, working with and learning from God, can change his life and his world in a positive way. According to Brigham Young, the real test of our lives here is to see whether we will learn to use knowledge and power as God does. Mormons see God as the ultimate scientist: He knows all laws of the Universe and operates through and by those laws. This is why, as Duane Jeffrey states elsewhere in this issue, "Mormonism [has] a basis for synthesis [of science and religion] that exists in few if any other Western religions." 

Mormonism's avowed commitment to and vigilant quest of truth could also help bring science and religion together. But this commitment must first be manifest in the Church before it can be manifest in the world, and this means that Mormons must be more willing to open their hearts and minds to discern and accept truth—even when it goes against cherished myths and traditions. This is what President John Taylor meant when he said, "Our religion . . . embraces every principle of truth and intelligence pertaining to us as moral, intellectual, mortal and immortal beings, pertaining to this world and the world that is to come. We are open to truth of every kind, no matter whence it comes, where it originates, or who believes it." 

Our belief that all truth can be circumscribed into one great whole should help us realize that the conflict between science and religion, though real and often of earth-shaking proportions, is after all only a temporary conflict caused by the fact that we now see through a glass darkly. Although our partial understanding of both science and religion prevents our seeing how they are unified, in our deepest selves we undoubtedly sense this unity. As Ihab Hassan has said, "Perhaps this is where science and prophesy meet: in deep fictions of the mind, still locked in emblems of our sleep." 

Finally, Mormonism, as a Christian religion, can help foster the unification of science and religion through affirming the central principle of Christ's life—love. The Christian message continually emphasizes the possibilities of new life through love. This is what Teilhard de Chardin calls "Christogenesis," the rebirth and unification of the world through Christ. Teilhard saw this as the last stage in man's evolutionary process. He says, ". . . it is above all Christ who invests Himself with the whole reality of the Universe; but at the same time it is the Universe which is illumined with all the warmth and immortality of Christ [what Mormons call "the Spirit of Christ," which is in all things]. So that finally .. . a new impulse becomes possible and is now beginning to take shape in human consciousness. Born of the psychic combination of two kinds of faith—in the transcendent action of a personal God and the innate perfectibility of a world in progress— it is an impulse, (or better, a spirit of love) that is truly evolutionary." And, one might add, revolutionary. Such a vision may seem radical to most Christians, but it is the ultimate flowering of the Mormon concept of God and man.

[post_title] => Science, Religion and Man [post_excerpt] => Dialogue 8.3/4 (1973): 4–6
The divergence of science and religion is essentially a modern phenomenon. Until the 18th century, theology was considered the queen of the sciences and scientists considered that their discoveries allowed them "to think God's thoughts after Him." [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => science-religion-and-man [to_ping] => [pinged] => [post_modified] => 2024-01-15 21:00:04 [post_modified_gmt] => 2024-01-15 21:00:04 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=17130 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 17143 [post_author] => 2300 [post_date] => 2018-04-27 14:30:59 [post_date_gmt] => 2018-04-27 14:30:59 [post_content] =>

Ever since his great synthesis, Darwin's name has been a source of discomfort to the religious world. Too sweeping to be fully fathomed, too revolutionary to be easily accepted, but too well documented to be ignored, his concepts of evolution[1] by natural selection have been hotly debated now for well over a century.[2] The facts of evolution as a current and on-going process are there for the observation of any who will exercise the honesty and take the time to look. The question of whether species evolve is no longer open; it has long since been resolved affirmatively. 

This is not to say, however, that we understand all the processes at work in evolving populations, or that we can answer unequivocally all the detailed questions concerning life forms in the distant past. But such shortcomings do not negate the fact that a great deal about evolutionary processes is known and is demonstrable; anyone who chooses to ignore the subject surely jeopardizes the development of an accurate view of the world around him. 

Most Mormons, it would appear, have addressed the question only perfunctorily. The same weakness exists in the vast majority of our published literature on the subject; the level of discussion, unfortunately, is far from sophisticated. Available works are usually the product of individuals who labor under the apparent belief that the concept of evolution per se is a threat to the survival or vitality of Mormonism, and that by attacking evolution they become defenders of the faith. Not only do such authors perceive evolution as a deep and fundamental threat to their personal religious convictions, but by various devices they try to convince us that their bias is also the official, or at least necessary, doctrine of the Church. Statements to the effect that one cannot harbor any belief whatsoever in any version of evolution and still be a real Latter-day Saint, or that evolution is the deliberate doctrine of Satan and a counterfeit to the gospel, that it is atheistic, communistic, etc., are not at all rare in the Mormon culture and popular literature. 

We do not propose here to consider the validity of the above positions, though readers should be fairly warned of the dangers inherent in a prima facie acceptance thereof. We direct ourselves instead to a more immediate concern: What is the doctrine of the Church on the subject of evolution, if any? We assert immediately that, among mortals, only the President of the Church can articulate a Church position—on anything. We have no desire to assume that role; the responsibility is awesome. But there is a glaring lack, in all published Mormon literature, of analysis of what the response to evolution by "the Church" really has been. To be sure, many publications bring together copious strings of quotes from general authorities, all carefully selected to fit the author's personal point of view. In a certain sense the present development will suffer from the same weakness; we make no attempt to catalogue and analyze every statement by every general authority on the subject. We do claim, however, to try for the first time to document another, broader, point of view fundamentally different from those which have been most ardently presented in the past twenty years, and to examine in as complete a context as is currently sufficiently documented the statements of the prophets of the Church on the matter. 

Our account may be disturbing to some. It is not designed to be. But the nature and history of the subject make it virtually impossible to avoid affront to someone. We have gone to considerable lengths to circumvent unnecessary conflict—we hope that any who find the review offensive will extend themselves sufficiently to appreciate why this investigation is necessary in the first place. And since the footnotes supply additional discussion, we urge their consultation on critical points. 

For statements on Church doctrine, we are traditionally referred to the four Standard Works.[3] But the standard works are not of themselves always sufficient, and it is recognized that essentially authoritative statements can also be originated by the presiding Prophet (the President) of the Church.[4] In addition, other priesthood holders may declare the mind of the Lord whenever they are "moved upon by the Holy Ghost."[5] This latter criterion introduces a high degree of subjectivity into the matter: how does an audience know when a speaker or writer is so moved? President J. Reuben Clark Jr., of the First Presidency, concluded that one knows only when he himself is so moved,[6] a conclusion that is religiously sound enough, but still too open for scholarly analysis. For some degree of necessary control in the matter, we shall in this article confine ourselves primarily to statements by the Presidents of the Church. Recognizing, however, that counselors in the First Presidency of necessity share a very close relationship to the President, sharing with him the responsibility for governing the affairs and doctrines of the Church,[7] we shall also on occasion extend ourselves to their testimony and counsel. The First Presidency, then, as the highest quorum in the Church, becomes our source of authoritative statements. The many statements by other authorities will be discussed only as needed for perspective, since they are not binding or fully authoritative.[8]

It should be recognized at the outset that the Authorities have never been comfortable with the ideas surrounding evolution. But that point must be kept in perspective: much of their discomfort is shared by many other religionists, lay men, and scientists. It would appear that the primary reasons for discomfort lie not so much in the question of whether living forms have evolved through time; rather, the concern seems to lie with the mechanisms, responsible for such projected changes. To believe that evolution is Deity's mode of creation is one thing; to ascribe it all to the action of blind chance is another. Darwin, of course, postulated natural selection as the major mechanism of change. In the century since, it has become plain that he was generally correct; natural selection is the major identified mechanism. Other mechanisms (e.g., genetic drift) have since been identified as well, and the picture is still far from complete. But the real question is not whether these mechanisms are functional; it is whether they are sufficient. Can they, as presently understood, explain the incredible complexity observable in the living world? Of more direct concern to those theologically-oriented is the question: Is there any need for, or evidence of, any processes that would be classed as divinely operated or controlled? Therein lies the crux: no one really has any good ideas as to how to look for such possible instances of divine intervention. How would one identify them? It has long been fashionable, in literature both within and without the Church, to implicate God wherever we lack adequate "natural" explanations; that is, God is present wherever there is a gap in our knowledge. This "god of the gaps" approach is demonstrably tantamount to theological suicide; the gaps have a way of being filled in by further research, and one must keep shifting to ever-new and more subtle gaps. Perception of the self-destructive properties of this approach seems to travel slowly, however, and it still remains the foundation stone of virtually every anti-evolution argument currently in vogue.[9]

The basic question of underlying and fundamental causes remains. If everything proceeds in a stochastic manner governed by the basic laws of chemistry, physics, and genetics, from whence come those laws? They appear to many to be orderly; does this indicate a purposeful design and a Designer?[10] At this point the decision becomes largely a leap of faith; there is no demonstrated answer. Darwin confessed himself unable to decide,[11] and his successors, whatever their persuasion, have been able to demonstrate no better solution. President David O. McKay summed up his views on the matter for teachers in the Church as follows: 

There is a perpetual design permeating all purposes of creation. On these thoughts, science again leads the student up to a certain point and sometimes leads him with his soul unanchored. Millikan is right when he says "Science without religion obviously may become a curse rather than a blessing to mankind." But, science dominated by the spirit of religion is the key [to] progress and the hope of the future. For example, evolution's beautiful theory of the creation of the world offers many perplexing problems to the inquiring mind. Inevitably, a teacher who denies divine agency in creation, who insists there is no intelligent purpose in it, will infest the student with the thought that all may be chance. I say, that no youth should be so led without a counterbalancing thought. Even the skeptic teacher should be fair enough to see that even Charles Darwin, when he faced this great question of annihilation, that the creation is dominated only by chance wrote: "It is an intolerable thought that man and all other sentient beings are doomed to complete annihilation after such long, continued slow progress." . . . The public school teacher will probably, even if he says that much, . . . go no farther. In the Church school the teacher is unhampered. In the Brigham Young University and every other Church school the teacher can say God is at the helm.[12]

Considerations as to God's possible role in evolutionary processes have not been characteristic of Mormon literature, especially not during the past two decades or so. The shift has been to an attack on evolution itself, fighting not "Godless evolution," but evolution per se. The question of whether this latter approach is legitimate brings us squarely back to our original task: a search for a Church position. 

The researcher soon faces an interesting problem: the available utterances on the subject are widely scattered and remarkably few. Compared with the output of other religious groups, Mormonism has produced a rather tiny body of literature that really deals directly with the matter of evolution.[13] At first this is rather frustrating. Commentaries on marriage systems, political involvement, and matters of church and state are extensive, and there is a sizeable literature on other social issues of the day. But there are very few direct confrontations with the questions raised by evolution. Why? Is it solely that the other items were more pressing? There can be no doubt that involvement with these other problems was contributory, but it is clear also that that is not alone a sufficient answer. The most likely further explanation appears to be that LDS doctrines central to the evolution issue were not well developed; they were still in a sufficient state of flux that no direct confrontation was really possible or necessary. Simply put, the Church had no defined basic doctrines directly under attack. 

On some matters, Mormonism was clearly on the side of "science" in the first place. In no real way could the Church be classed as party to the literalistic views of the more orthodox Christian groups of the day. Indeed, Mormonism was a theologic maverick to nineteenth-century Christian orthodoxy. The differences were deep and profound, and on several issues, Mormonism was much more closely aligned with the prevailing concepts of science.[14] Why then should the Mormon theologians rush to an attack on science as other groups did? They should not, and they did not. 

Such a view will not be apparent to many. Let us, therefore, quickly proceed to its examination. 

For all intents and purposes, the modern story of evolution began November 24,1859, the date of the release of Darwin's classic, On the Origin of Species. The earlier announcement of the theory of evolution by natural selection, presented as joint papers by Darwin and A. R. Wallace on the evening of July 1, 1858 to the Linnaean Society, had caused little stir. Not so the 1859 publication. Public response was immediate and heated. A recounting of that story is not necessary here, however, since it is readily available elsewhere.[15] Our major concern is to identify the central points of the issues that were of interest in Mormon theology. Mayr[16] has recently postulated six specific issues that seem to lie at the heart of the revolution of thought precipitated by Darwin. These do not translate easily to the LDS world-view, however, so we would propose the following five basic concepts as useful for comparing Mormonism to the doctrinal positions taken by science and prevailing Christian theology of the last century.[17] The theological posits are: 

1. Belief in an ex nihilo creation, that is, creation out of nothing.
2. Belief that the earth was created in six twenty-four hour days, and is only about 6000 years old. 
3. Fixity or immutability of species; that all species were created originally in Eden by the Creator and do not change in any significant way. 
4. Contention that life is dependent on an activating vital force which is immaterial and divine, i.e., spirit or soul. 
5. Special creation of man; that God literally molded man's body from the dust of the ground and blew into it the breath of life, the spirit.[18]

Let us now examine the alignment of Mormonism on these issues. Was the doctrine of the Church as of 1859 (and for, say, twenty or so years thereafter, the period of the hottest debates) such as to align it with the orthodox theologies of the day, or with science, or with neither?

1. Creation Ex Nihilo 

A formal definition of this view is ". . . God brings the entire substance of a thing into existence from a state of non-existence . . . what is peculiar to creation is the entire absence of any prior subject-matter. . . ."[19] The doctrine is elsewhere explained as God's "speaking into being" everything except Himself.[20] The doc trine in its contested form meant literally out of nothing; more recent attempts to cast it in the light of matter-energy conversions are distortions that betray the earlier meaning. The doctrine, of course, finds little place in contemporary science, which deals with conversions of matter and of energy, but is generally foreign to the idea of something coming from nothing. 

It is difficult to find in Mormonism a philosophical doctrine that has been more consistently and fervently denounced, that is more incompatible with Mormon theology, than creation ex nihilo. The concept is usually derived straight from Gen. l:1: "In the beginning God created the heaven and the earth," and it is right there that Joseph Smith chose to set the theologians straight: 

Now I ask all the learned men who hear me, why the learned men who are preaching salvation say, that God created the heavens and the earth out of nothing, and the reason is they are unlearned; they account it blasphemy to contradict the idea, they will call you a fool.—I know more than all the world put together, and the Holy Ghost within me comprehends more than all the world, and I will associate with it. The word create came from the word baurau; it does not mean so; it means to organize; the same as a man would organize a ship. Hence we infer that God had materials to organize the world out of chaos; chaotic matter, which is element, and in which dwells all the glory. Element had an existence from the time he had. The pure principles of element, are principles that can never be destroyed. They may be organized and re-organized; but not destroyed.[21]

This view of Joseph's has been affirmed ever since in Mormonism. Brigham Young continually preached it,[22] as did his contemporaries among the general authorities. 

Creation ex nihilo has further meaning as well: that all things were created directly by God, and therefore have contingent being.[23] In this view, only God had necessary being; all else is dependent (contingent) on Him for both its existence and continued maintenance. This concept leads to a morass of theological difficulties, not the least of which are responsibility for evil and denial of the free agency of man.[24] Mormonism, while it does not escape completely from some of these difficulties, begins from a completely different base. For one thing, God is not the creator of matter, as is indicated in the above statement from the founder of the faith. "Element had an existence from the time he had . . . it had no beginning, and can have no end." The statement (part of a funeral sermon) continues: 

. . . so I must come to the resurrection of the dead, the soul, the mind of man, the immortal spirit. All men say God created it in the beginning. The very idea lessens man in my estimation; I do not believe the doctrine, I know better. Hear it all ye ends of the world, for God has told me so. I will make a man appear a fool before I get through, if you don't believe it. I am going to tell of things more noble—we say that God himself is a self existing God; who told you so? it is correct enough, but how did it get into your heads? Who told you that man did not exist in like manner upon the same principles? (refers to the old Bible,) how does it read in the Hebrew? It don't say so in the Hebrew, it says God made man out of the earth, and put into him Adam's spirit, and so became a living body. 

The mind of man is as immortal as God himself. I know that my testimony is true, hence when I talk to these mourners; what have they lost, they are only seperated from their bodies for a short season; their spirits existed co-equal with God, and they now exist in a place where they converse together, the same as we do on the earth. Is it logic to say that a spirit is immortal, and yet have a beginning? Because if a spirit have a beginning it will have an end; good logic. I want to reason more on the spirit of man, for I am dwelling on the body of man, on the subject of the dead. I take my ring from my finger and liken it unto the mind of man, the immortal spirit, because it has no beginning. Suppose you cut it in two; but as the Lord lives there would be an end.—All the fools, learned and wise men, from the beginning of creation, who say that man had a beginning, proves that he must have an end and then the doctrine of annihilation would be true. But, if I am right I might with boldness proclaim from the house tops, that God never did have power to create the spirit of man at all. God himself could not create himself: intelligence exists upon a self existent principle, it is a spirit from age to age, and there is no creation about it.[25]

Thus both matter and the basic identity of man share necessary existence with God.[26] The doctrines have been taught continually and often by Joseph's successors.[27] As regards the first point of contention in the science-theology argument, Mormonism was unalterably opposed to the basic position of Christian theology.[28] In the dispute on this point between science and then-current theology, Mormonism was clearly allied much more closely with science. 

2. Age of the Earth 

The predominant doctrine of the 19th century Christian theologians is too well known to need extensive documentation. While not all were as extreme as John Lightfoot, the Vice-Chancellor of the University of Cambridge, who insisted that the creation of the earth took place "on the twenty-third of October, 4004 B.C., at nine o'clock in the morning," the range of views for the earth's age ranged generally from about 4000 years to 6000 years before Christ.[29] Science, of course, could not agree. Darwin, in the first edition of The Origin, had opted for an age of several hundreds of millions of years. Even devoutly religious scientists who opposed him, such as the physicist Lord Kelvin, produced estimates for the earth's age in the neighborhood of twenty million years. Estimates this small were painful to Darwin, since they seemed far too short for natural selection to have played the role he postulated for it.[30] But they were even more painful to the orthodox theologians; they demonstrated in virtually final fashion that a 6000-year age was beyond defensibility. Kelvin's arguments, and others similar, have since been generally laid to rest. The age of the earth has been pushed ever further back; current estimates range from 4.5 - 5.0 billion years. While no really precise age has been determined, the main issue, that of an old earth or a young one, has been essentially resolved.[31] Our concern here, however, is not how old the earth really is. Rather, it is: where did the Church line up on the issue? The answer is: no where—it was wide open on the matter. 

Mormon speakers ranged widely in their expressions. Statements from the presiding quorum kept the Church non-committed, but open for the long age. There seems to have been no one who opted for twenty-four hour creation days, unless one wishes to so interpret Oliver Cowdery's statement, published while he was Assistant (Associate) President of the Church, that he believed the scriptures "are meant to be understood according to their literal reading, as those passages which teach us of the creation of the world, . . ." (emphasis his[32]). Joseph Smith left no clear-cut statement on the matter. On the Christmas day after Joseph's death, his close associate W. W. Phelps wrote a letter to Joseph's brother William, who was in the east. Therein he refers, among other things, to the contributions of Joseph, and to the eventual triumph of truth and Mormonism. One of Joseph's accomplishments, of course, was the Book of Abraham, an incomplete text produced in conjunction with some Egyptian papyri. Phelps exults: 

Well, now, Brother William, when the house of Israel begin to come into the glorious mysteries of the kingdom, and find that Jesus Christ, whose goings forth, as the prophets said, have been from of old, from eternity: and that eternity, agreeably to the records found in the catacombs of Egypt, has been going on in this system, (not this world) almost two thousand five hundred and fifty five millions of years: and to know at the same time, that deists, geologists and others are trying to prove that matter must have existed hundreds of thousands of years; —it almost tempts the flesh to fly to God, or muster faith like Enoch to be translated. . .[33]

This reference has been cited many times in Mormon literature. Some have used it to indicate that the planet earth is 2.55 billion years old; others, taking careful note of the phrase in parentheses, insist that it has no such meaning, that it refers to a much larger physical system and has no bearing on the age of the earth. The latter view argues that "not this world" specifically rules out the earth as the object of reference. A critical examination of terms in Joseph's vocabulary, however, indicates that he had made definite distinctions between the terms "earth" and "world": "earth" was the planet upon which we live, "world" referred to "the human family."[34] One also finds that Joseph did not, in his sermons, utilize these definitions consistently. The disagreement over the interpretation of the above passage, however, centers on how Phelps meant the term "world"— in the way Joseph had defined it, or in some other sense. The question is moot, since Phelps nowhere clarified the statement. The very evident context, however, of Phelps' rejoicing over the developing agreement between this statement and the efforts of "geologists" to establish long time-spans gives strong support to those who interpret the statement as applying to the planet earth. The one certain point that can be drawn from this statement is that Joseph's world-view was not bounded by the orthodox Christian theologies of the day. His mind ranged far more widely, a point that is plentifully evident from even a casual analysis. 

During the nineteenth century subsequent to Joseph's death, one can find many further statements by Mormon authorities pertaining to the age of the earth. A prominent one, taught by certain apostles, was that the seven days of creation were each 1000 years in duration, and the earth was therefore approximately 13,000 years old, calculating approximately 6000 years since the Adamic Fall. This concept received limited support from members of the First Presidency, but their statements carried also a sentiment of very different flavor: the age of the earth was really not known and did not matter; the important thing to realize was that God created it. As Brigham Young expressed it, in a comment fraught with implications: 

It is said in this book (the Bible) that God made the earth in six days. This is a mere term, but it matters not whether it took six days, six months, six years, or six thousand years. The creation occupied certain periods of time. We are not authorized to say what the duration of these days was, whether Moses penned these words as we have them, or whether the translators of the Bible have given the words their intended meaning. However, God created the world. If I were a sectarian I would say, according to their philosophy, as I have heard many of them say hundreds of times, "God created all things out of nothing; in six days he created the world out of nothing." You may be assured the Latter-day Saints do not believe any such thing. They believe God brought forth material out of which he formed this little terra firma upon which we roam. How long had this material been in existence? Forever and forever, in some shape, in some condition.[35]

A further lengthy but valuable passage from Brigham Young voices the same sentiments, amplifies them in regard to the scriptures, and emphasizes that revelations then in possession of the Church were insufficient to settle the matter, and that the truth would be obtained only if God were to give specific revelation on the subject: 

It was observed here just now that we differ from the Christian world in our religious faith and belief; and so we do very materially. I am not astonished that infidelity prevails to a great extent among the inhabitants of the earth, for the religious teachers of the people advance many ideas and notions for truth which are in opposition to and contradict facts demonstrated by science, and which are generally understood. Says the scientific man, "1 do not see your religion to be true; I do not understand the law, light, rules, religion, or whatever you call it, which you say God has revealed; it is confusion to me, and if I submit to and embrace your views and theories I must reject the facts which science demonstrates to me." This is the position, and the line of demarcation has been plainly drawn, by those who profess Christianity, between the sciences and revealed religion. You take, for instance, our geologists, and they tell us that this earth has been in existence for thousands and millions of years. They think, and they have good reason for their faith, that their researches and investigations enable them to demonstrate that this earth has been in existence as long as they assert it has; and they say, "If the Lord, as religionists declare, made the earth out of nothing in six days, six thousands years ago, our studies are all in vain; but by what we can learn from nature and the immutable laws of the Creator as revealed therein, we know that your theories are incorrect and consequently we must reject your religions as false and vain, we must be what you call infidels, with the demonstrated truths of science in our possession; or, rejecting those truths, become enthusiasts in, what you call, Christianity."

In these respects we differ from the Christian world, for our religion will not clash with or contradict the facts of science in any particular. You may take geology, for instance, and it is a true science; not that I would say for a moment that all the conclusions and deductions of its professors are true, but its leading principles are; they are facts—they are eternal; and to assert that the Lord made this earth out of nothing is preposterous and impossible. God never made something out of nothing; it is not in the economy or law by which the worlds were, are, or will exist. There is an eternity before us, and it is full of matter; and if we but understand enough of the Lord and his ways, we would say that he took of this matter and organized this earth from it. How long it has been organized it is not for me to say, and I do not care anything about it. As for the Bible account of the creation we may say that the Lord gave it to Moses, or rather Moses obtained the history and traditions of the fathers, and from these picked out what he considered necessary, and that account has been handed down from age to age, and we have got it, no matter whether it is correct or not, and whether the Lord found the earth empty and void, whether he made it out of nothing or out of the rude elements; or whether he made it in six days or in as many millions of years, is and will remain a matter of speculation in the minds of men unless he give revelation on the subject. If we understood the process of creation there would be no mystery about it, it would be all reasonable and plain, for there is no mystery except to the ignorant. This we know by what we have learned naturally. . . .[36]

We need not belabor the issue. Though Mormon speakers expressed a diversity of opinions, the First Presidency kept the door open, clearly opposed to orthodox Christian theology, clearly sympathetic to the position of science. 

3. Fixity of Species 

If ever anyone bought a bad deal, it was when the theologians adopted the stance that species do not change, that they remain as "originally created." The irony of the matter is that the concept of species is not a religious one at all, but an idea prematurely bought from science. The Genesis scriptures speak only of "kind," which to this day no one has been able to define.[37] Indeed, no one worried much about it until about the 17th century, when John Ray (1627-1705) and Carl Linne (Linnaeus) (1707-1778) laid the foundations of modern taxonomy and systematics. 

Linne's case is particularly instructive. Few men have ever so completely dominated the intellectual thought of the time in which they have lived; he was indeed "a phenomenon rather than a man." His gift and passion for cataloguing organisms was unmatched and contagious; everyone wanted to get into the act, and plants and animals were brought to him from all over the world for proper naming and classification. His passion was to name everything, to pigeonhole all living things into the neat compartments he attributed to the Genesis creations. He thus declared a fixity of species, that they were unchangeable entities each descended from a specific Edenic stock, by whose analysis one caught a glimpse of the Creator at work. But the concept was an illusion, one which tragically escaped from his control. For it caught the human fancy, and when in his maturity Linne realized that it was worthless, he was powerless to change its hold upon the human mind. By then it had been seized upon as a classic demonstration of the neatness of creation; "kind" had been construed as meaning "species," and the trap for theologians was thus laid—innocently but nonetheless surely. It was Linne's own fame and prodigious work which sprung the set. Not only did it become painfully evident to anyone who wished to look that there were just too many species to be explained so simply—if Adam had named them all in the Garden, he'd likely have been at it yet—but their distributions, their intermediate grades, their hybridizations, were irrefutably beyond so neat a conception. But the damage was done: theologians would have their species, and they would have them fixed. 

Science, self-correcting as it eventually is, finally grew openly beyond the strictures of Linne's early concepts. Species quite obviously could change, and did—both in time and in space. The battle with theology was joined after Darwin proposed a mechanism (natural selection) for such change.[38]

A very real problem was the lack of an adequate concept of what a species really is. We need not discuss the attempts at definition here, only point out that the concept is problematical. That does not indicate that species do not exist, they most definitely do. As with many other things, however, precise definitions are virtually impossible, and before one can really understand anyone else on the matter, he must know what definitions are being used.[39] Such a common word to hide such complexity! But statements on the subject, without definitions, are virtually meaningless. 

What position on species fixity was being articulated by the leaders of Mormonism up to and during this critical time? It is readily apparent that the subject hardly ever caught their attention. Casual statements that God and man are of the same species occur periodically, but beyond that the treatment is sketchy. The following lean sampling represents all the authoritative statements that have come to our attention. 

Speaking on divine decrees, Joseph Smith comments: 

The sea also has its bounds which it cannot pass. God has set many signs on the earth, as well as in the heavens; for instance, the oak of the forest, the fruit of the tree, the herb of the field—all bear a sign that seed hath been planted there; for it is a decree of the Lord that every tree, plant, and herb bearing seed should bring forth of its kind, and cannot come forth after any other law or principle.[40]

No mention here of species at all, just the generic "kind/' and no definition of that. For all its looseness, however, a certain sentiment is evidenced which tends to favor some sort of fixity. 

Eighteen years later, in i860, Brigham Young touched the subject. In a sermon launched upon the matter of death and the resurrection, he asserts: 

The whole Scriptures plainly teach us that we are the children of that God who framed the world. Let us look round and see whether we can find a father and son in this congregation.

Do we see one an elephant, and the other a hen? No. Does a father that looks like a human being have a son like an ape, going on all fours? No; the son looks like his father. There is an endless variety of distinction in the few features that compose the human face, yet children have in their countenances and general expression of figure and temperament a greater or less likeness of their parents. You do not see brutes spring from human beings. Every species is true to its kind. The children of men are featured alike and walk erect.[41]

The hyperbole here is evident, and strictly speaking, completely disrupts the point its author is making. As it is, it certainly does not constitute a statement against the scientific version of changes in species. Modern evolution texts carry many statements concerning developmental canalization and genetic homeostasis which express these same concepts. But with all that, there is still, in President Young's words, a sentiment toward fixity of species—again subject to whatever is meant by "species." 

These would seem to constitute virtually all the authoritative statements that were applicable during the early Darwinian period. The extreme paucity and ambiguity of such addressments is evident from the fact that the favorite citation on the subject by current Mormon anti-evolutionists is cited, usually, as one from "President Charles W. Penrose, of the First Presidency." While it is slightly more explicit than the ones we have here discussed, it simply is not admissible, since it was in actuality made by Elder Charles W. Penrose nearly twenty years before he was called to be a general authority, let alone a member of the First Presidency.[42]

In summary, the doctrine of species fixity was virtually ignored by official Mormon spokesmen. When they did broach the subject, their statements were very general and in no real way proscriptive from a professional's point of view. The authors were not speaking to professionals, however, and the sentiment of their statements took on the flavor of the theology of their day. In the light of subsequent research and observation, such a sentiment is unfortunate; it mars a rather neat record. It is quite evident, however, that a doctrine of species fixity was not a matter of prime concern in the nineteenth-century Church. 

4. Vitalism: Necessity for an Outside 'Spirit' or Vital Force 

While not strictly a product of the Darwinian revolution, and in many ways antedating it, the question of the existence of a vital force became an important part of the discussion surrounding Darwinism. Particularly was this true in later years of the furor, when vitalism was offered in various forms as an alternative to the causalistic theories which were more in vogue.[43] As with previous topics, our purpose here is only to look at the range of authoritative Mormon expression. We must restrict ourselves to a fairly superficial treatment, though the subject as treated in Mormonism virtually screams for a thorough and searching analysis. And although it is highly unlikely that any reviewer can wrap it all up in one neat package, it becomes quickly evident to the inquiring student that Mormon spokes men have glimpsed a view radically different from the usual Christian positions, and their tenets are very poorly appreciated in the Church today. This lack of appreciation seems to result more from neglect than from any shift in doctrine; the basic conceptions, tentative though they are, have become so covered with the cobwebs of time that to most Mormons today even their basic outlines are obscured; the general concept in the Church today is essentially standard Christian.

A recent treatment outlines the basic positions of vitalism and mechanism thusly: 

Life, the subject matter of biology, is a phenomenon intimately connected with matter. Biology, therefore, must be concerned with the relationship between matter and the phenomenon we call life. Animate and inanimate things have matter in common, and it is in their materiality that the two can best be compared. In this comparison, two theories, vitalism and mechanism, compete for the mastery. The vitalist sees in a living organism the convergence of two essentially different factors. For him matter is shaped and dominated by a life principle; unaided, matter could never give rise to life. The mechanist, on the other hand, denies any joint action of two essentially different factors. He holds that matter is capable of giving rise to life by its own intrinsic forces. The mechanist considers matter to be "alive." The vitalist considers that something immaterial lives in and through matter.[44]

To Mormons, the divergence between the two approaches is best seen in two basic issues: 1) whether an outside force is necessary to make a body "alive," and 2) whether such an outside force is material. The popular nineteenth-century theological view, of course, was that life is due to a non-material force. Science, profiting from a long series of investigations on spontaneous generation dating primarily from Redi in the seventeenth century to Pasteur and Tyndall in the 1870s, became associated with mechanism (materialism). The reason for this latter association is not that either view has been rigorously proved. It is rather that the materialistic view allows experimentation whereas the vitalist view does not, since one is hard pressed to experiment with immaterial "things." As Hardin has so aptly put it: "The mechanistic position, whether it is ultimately proved right or wrong, has been and will continue to be productive of new discoveries. Indeed, if vitalism is ultimately proved to be true, it is the mechanist who will prove it so.”[45]

It is doubtful that anyone can meaningfully pinpoint a consistent Mormon "doctrine" on the matter of spirit, life, vital force, etc. Teachings of the Church in the nineteenth-century were in a high state of flux when it came to issues beyond the simple basics. Terms were confused and misused, concepts were loosely defined and highly fragmented, speculation was rife. B. H. Roberts points out quite correctly that Joseph Smith sometimes used the terms "intelligence," "mind," "spirit," and "soul" interchangeably—"life" and even "light" could be added to the list as well.[46] There is no satisfactory synthesis of the subject, and it is doubtful that one could be produced. Andrus' imaginative treatment[47] is as wide-ranging as any available and should be consulted carefully if for no other reason than its references. Roberts7 brief discussion[48] is valuable.

That Mormonism accepts the view that living things possess spirits is well known as a general concept; man's spirit, of course, is said to be the result of a spirit birth in a pre-mortal state. That "spirit,” "spirits,” (~~"life," etc.), are material is likewise clear: "There is no such thing as immaterial matter. All spirit is matter, but it is more fine or pure, and can only be discerned by purer eyes; . . . it is all matter.”[49] This canonized statement has been the justification for a long series of missionary tracts and doctrinal assertions that have spelled out very clearly that Mormonism is a materialistic system. There can be no identification whatever with sentiments of immateriality. Immateriality, to the early Mormons, was virtually synonymous with atheism; in either case, one ended up with his hopes pinned on nothing. 

Beyond this point, however, the thinking becomes more tortuous. The philosophically-minded Pratt brothers, Orson and Parley, were by far the most expensive and explicit on the matter. But certain aspects of Orson's writings eventually drew public denouncement from the First Presidency under Brigham Young.[50] Parley's master work, decades after his death, was subjected to a rather unscrupulous editing and reworking, anonymously and without any warning to subsequent readers. Later editions passed off as Parley's some teachings quite foreign to those of the original text.[51] These incidents, as perhaps no others in Mormonism, emphasize the fact that only the First Presidency comprises an authoritative source for doctrinal analysis. 

But from all the heady teachings on spirit during these decades comes a perception germane to our present consideration. The Pratts worried about the spirit natures of animals and plants, becoming in many ways almost Aristotelean, and these writings were not among those censured. The sentiment went further, to include the earth itself as a living thing by virtue of its having spirit or a spirit; indeed it was taught that all matter was possessed of spirit, that spirit pervades all matter. The material of the body of a man is thus possessed of spirit independent from his spirit. Spirit or life is thus a property of matter itself. From here, we can do no better than to let Brigham Young develop it directly, in an 1856 discourse. Speaking of "natural, true philosophy," and developing the idea that the processes associated with death are really a manifestation of inherent life in matter, he continues: 

What is commonly called death does not destroy the body, it only causes a separation of spirit and body, but the principle of life, inherent in the native elements, of which the body is composed, still continues with the particles of that body and causes it to decay, to dissolve itself into the elements of which it was composed, and all of which continue to have life. When the spirit given to man leaves the body, the tabernacle begins to decompose, is that death? No, death only separates the spirit and body, and a principle of life still operates in the untenanted tabernacle, but in a different way, and producing different effects from those observed while it was tenanted by the spirit. There is not a particle of element which is not filled with life, and all space is filled with element; there is no such thing as empty space, though some philosophers contend that there is. 

Life in various proportions, combinations, conditions, etc., fills all matter. Is there life in a tree when it ceases to put forth leaves? You see it standing upright, and when it ceases to bear leaves and fruit you say it is dead, but that is a mistake. It still has life, but that life operates upon the tree in another way, and continues to operate until it resolves it to the native elements. It is life in another condition that begins to operate upon man, upon animal, upon vegetation, and upon minerals when we see the change termed dissolution. There is life in the material of the fleshly tabernacle, independent of the spirit given of God to undergo this probation. There is life in all matter, throughout the vast extent of all the eternities; it is in the rock, the sand, the dust, in water, air, the gases, and, in short, in every description and organization of matter, whether it be solid, liquid, or gaseous, particle operating with particle.[52] 

Elsewhere President Young repeatedly refers to "organization" as a key factor in determining differences in life quality.[53] Taken with the concepts above, such teachings bear a striking resemblance to those of the mechanists-materialists. To the mechanist, life is an expression of a unique combination or organization of matter. To President Young, all matter has life as an inherent property, and organization is the key to its different manifestations. To both, life is an expression of matter. At this most fundamental of levels, the differences between science and Mormonism, as taught by Brigham Young, are reduced to mere semantics. The points of agreement are profound. President Young's entire philosophy, to be sure, ranges far beyond matters that are in the realm of science either then or now, but at the fundamental level, at the point of contact, they are in essential agreement. Should Mormonism then have taken the field against the materialism of science? Scarcely. 

5. Special Creation of Man 

Here we venture into the hottest point of discussion. In The Origin, Darwin marshalled one powerful argument after another for the evolution of plant and animal species from earlier forms. Only one sentence, on the penultimate page, was directed to man: "Much light will be thrown on the origin of man and his history." Though Darwin himself was not yet ready to tackle this problem of ultimate concern, others were not so retiring. The issue was quickly joined; Huxley and others insisting that man's body was related to and derived from other life forms, the theologians of the day insisting with equal vehemence that the body was the result of a special creative act, independently developed from the dust of the ground by the shaping hand of the Creator, and activated by "the breath of life." Mormons accept as part of their canon the same scripture-text on this matter as was utilized by the orthodox theologians, of course, that of the King James rendition, Genesis 2:7. The Book of Abraham, first published in the Times and Seasons in 1842 and canonized in 1880, expresses virtually the same thought as Genesis (cf. 5:7). The Book of Moses, proclaimed as a revealed restoration of the Genesis text, dating from 1830 and also canonized in 1880, is the most explicit of the three: "And I, the Lord God, formed man from the dust of the ground, and breathed into his nostrils the breath of life; and man became a living soul, the first flesh upon the earth, the first man also; . . ." (3:7). A literal reading of the passage lends itself to no other interpretation at all but that of the special creationists; it is clearly stated, and proscriptive of any other interpretation. The fascinating point, however, is that with the possible exception of Apostle Orson Pratt, no major Mormon spokesman seems to have taken the full passage literally.[54] The intense scriptural literalism with which some current writers try to paint LDS presidents falls apart completely on this and related passages. 

No president or member of the First Presidency, so far as we have been able to discover, has ever accepted the idea of special creation of man's body, or of anything else, for that matter. An examination of Joseph Smith's teachings reveals an idea, never expressed in detail, that man came via an act of natural procreation. That sentiment runs generally through the teachings of his successors,[55] but we shall find that it is not so clearly spelled out as some have assumed. If by a natural act of procreation, then from whom, and by what specific natural process? For "natural processes," as we shall see, encompass a wide variety of possibilities. To assist the focus of our inquiry, we shall refine the question to: from whence came man's body? 

Joseph's clearest statement on the matter seems to be: "Where was there ever a son without a father? And where was there ever a father without first being a son? Whenever did a tree or anything spring into existence without a progenitor? And everything comes in this way."[56]

Under Brigham Young's administration, however, more specific teachings were developed. Beginning in 18.52, the same year that plural marriage was openly acknowledged to the world, President Young himself served notice of a new doctrine in Mormonism: that Adam and Eve were resurrected beings, exalted to Godhood from a mortality on another and older sphere. They had produced the spirits of all men, and had then come to this earth, degraded their "celestial" bodies so that they could produce the bodies of Abel, Cain, Seth, etc.[57] In short, Adam in President Young's views occupied essentially the same place that modern Church members reserve for Elohim; Elohim was regarded as the Grandfather in Heaven, rather than Father. We needn't concern ourselves here with the details of the doctrine, only that Adam was purported to have had a resurrected body, and to have begun the family of man by direct sexual union and procreation. 

The response of Church members to the doctrine, however, is of importance to us. With most, the concept does not seem to have been well-received. Indeed, President Young's public sermons on the matter quickly began to skirt the issue, referring to it continually but obliquely. In private, he and his colleagues taught it affirmatively.[58] With rare exceptions, the writings and sermons of Mormons in general just avoided the entire issue, or couched it in the vague terms characteristic of the scriptures, and offered no commentary. The matter of Adam and Adam's body was left essentially undeveloped. 

There was one notable exception: Orson Pratt, the Apostle. On this matter, at least, Orson seems to have accepted the scriptures quite literally, and could not reconcile them with the doctrine from President Young. Beginning in 1853, he published a periodical entitled The Seer, and in its pages promulgated a doctrine that sounded far too much like special creation. Articles from The Seer were re-published in England in the pages of the Millenial Star, a situation not pleasing to the Church presidency. As early as January 1855, Brigham Young requested the editor of the Star to refrain from any further publication of material from The Seer, citing "erroneous doctrine" as the reason.[59]

Five years later, Orson Pratt himself brought the matter into the open, in a dramatic sermon during the regular Sunday morning worship service in the Salt Lake Tabernacle, January 29, i860. Confessing the error of his ways, Orson sued for reconciliation to the Church and to his brethren of the Quorum of the Twelve Apostles and the First Presidency. A few months later a "carefully revised" version of his speech was published in the Deseret News, followed by a formal statement from the First Presidency, listing several explicit errors in Orson's writings.[60] The first item cited was the matter of Orson's teachings concerning Adam's having been formed "out of the ground." While the teachings were summarily dismissed with the statement that they were not true, President Young refrained from imposing his own doctrine on the Church. The refutation simply states that with regard to Adam 

it is deemed wisest to let that subject remain without further explanation at present, for it is written that we are to receive 'line upon line/ according to our faith and capacities, and the circumstances attending our progress. 

The careful handling of this matter by President Young is significant. What was the Church to believe? Orson's teachings had been refuted, but nothing had been specified in their place. And no further pronouncements of any official character to clarify the matter were forthcoming throughout the remainder of the century. 

Where, then, in the early days of the debates between science and theology, did Mormonism find its closest affinities? On our first doctrine, ex nihilo creation, Mormonism was clearly allied with science. The matter of the earth's age was an open one, that of fixity of species virtually ignored, that of materialism and vital forces in a state of flux but with certain definite fundamental agreement with science. Only on the subject of special creation could Mormonism be tied in any significant way to orthodox Christianity, and even that was tenuous. Darwin's book, as we have noted, was published November 24,1859. Just sixty-six days later, on January 29, 1860, Orson Pratt began the severing of that one tie. The closeness of the dates is almost certainly coincidental, since (among other reasons) news travelled slowly to Utah in those days—Orson's action is not to be viewed as a response to Darwinism. But, in retrospect, his action (and the First Presidency's response) was significant none-the-less; the incident may well have put a damper on further doctrinal development. Certain it is that, considering the duration and intensity of the debate in non-Mormon theological circles, nineteenth-century Mormonism produced relatively little in the way of relevant commentary. Let us shift now, in our inquiry, from the study of basic Mormon teachings applicable at the time of Darwin's book, to a documentation of subsequent pertinent commentary and response. 

In 1882, President John Taylor published his Mediation and Atonement, in which he makes probably the strongest statement by any president favoring the fixity of species,[61] thus inching the Church toward the theologians' position. But during the following year his first counselor, George Q. Cannon, twice reaffirmed the sentiment of Brigham Young that the creation periods were "periods of time," and that Joseph Smith had anticipated science on the matter of the earth's age. Rejoicing that science was bolstering the prophet, Cannon summarizes: "Geologists have declared it, and religious people are adopting it; and so the world is progressing."[62] But Cannon was eclectic in his beliefs; acceptance of an old earth was not to be taken as an acceptance of Darwinism—at least so far as it applied to man. In an editorial in 1883 he made it clear that he regarded belief in "Darwin's theories concerning the origin of man" as evidence of spiritual apostasy.[63] This sentiment is not surprising, since Cannon had often expressed himself in similar vein before being called to the First Presidency,[64] and was a firm believer in the Adamic doctrines taught by President Young.[65]

The general feeling of the Church in the latter 1800's, however, was that science would continue to demonstrate the validity of the Mormon positions; indeed a rather heady flirtation with science affixed itself on the Church. The Church hierarchy seems to have rejoiced at the goodwill generated by James E. Talmage's reception in scientific circles, his participation and membership in esteemed societies, and his trips to England and Russia. In 1896, Talmage became the holder of Mormonism's first real doctorate degree; he was joined in this doctorate distinction in 1899 by John A. Widtsoe and Joseph F. Merrill. All three of these physical scientists later became prominent apostles and articulate spokesmen in the Church. 

***

So closed the 1800's, and Mormonism, past the major hurdles in her long political feud over plural marriage, and newly-sequestered under the government of statehood, plunged with high anticipations into the twentieth-century. 

Davis Bitton[66] has rightly pinpointed these years, the turn of the century, as a period critical in Mormonism, during which the prevailing optimism toward science and reason began to erode. But this cooling of ardor must not be over-rated; the antagonism which has seemed to pervade recent times is seen more correctly, for science at least, as a product of only the last couple of decades. 

The Improvement Era, in the early years of the century, regularly ran articles by Talmage, Widtsoe, Frederick Pack, and others, extolling areas of agreement between science and Mormon theology. These articles show a degree of caution and sensitivity toward evolution that is quite commendable. The distinction between evolution per se and Darwinism was periodically noted, a point which many later writers seem to have missed. The then recent re-discovery of Mendel's paper and the principles of genetics, and the question of their compatibility with Darwinism, were sensed, and watched with interest. But the concept that science and Mormonism were a basic unity is evident throughout; it forms the dominant theme. 

The year 1909 marks a particularly significant occasion, the centennial of Dar win's birth as well as the 50th anniversary of the publication of The Origin of Species. The scientific literature had been building toward the event for several years. Debates on the "current status of Darwinism," its validity in areas of concern other than biology, its relation to religion, philosophy, etc., abounded in the lay literature as well. Centennial celebrations were held in both Europe and America; the Pontifical Biblical Commission, appointed in 1902 by Pope Leo XIII, finally issued its long-awaited report on the interpretation of Genesis. In Mormonism, the atmosphere was quieter, but the discussion was not ignored. The YMMIA manual for the year (Joseph Smith as Scientist, by Widtsoe)[67] reaffirmed the ideas concerning the age of the earth that were taught earlier by Brigham Young and others, that the earth was very old, and that the creative days were indefinite periods. The manual evoked a series of questions on the matter to Church headquarters, which were discussed in a special column of the Improvement Era. The managing editor, Edward H. Anderson, defended the manual. He contended that the verses of D&C 77:12, cited by questioners in support of a young-earth theory, did not apply to the subject in any meaningful way at all, and turned the column over to Widtsoe for further discussion. Widtsoe proceeded to dismiss the twenty four-hour-day view, the 1000-year-day concept, the D&C 77:6, 7,12 argument, as well as the theory attributed to Joseph Smith that the earth had been formed of fragments of other worlds.[68] The following month's issue published as its lead article an essay by Apostle Charles W. Penrose entitled, "The Age and Destiny of the Earth," which also argued for an old earth of indefinite age.[69] And in November, 1909, the first formal statement on evolution from the First Presidency was published; it was signed by Joseph F. Smith, John R. Winder, and Anthon H. Lund.[70] Entitled "The Origin of Man," it is widely cited by some individuals in the Church as "the official pronouncement against evolution." A more honest appraisal of the text, its background, and its meaning to later presidents, indicates that such a judgment is inaccurate. The document is carefully and sensitively worded. Its message is an affirmation that man is the spirit child of divine parent age, is in the image of God both in body and spirit, and that all men are descendants of a common ancestor, Adam. Lengthy scriptural passages are cited in affirmation of man's divine spiritual pedigree. And the origin of man's physical body? Three paragraphs are relevant, and form the crux of the matter; we shall denote them Paragraphs 12 to 14:[71]

Adam, our great progenitor, "the first man," was, like Christ, a pre-existent spirit, and like Christ he took upon him an appropriate body, the body of a man, and so became a "living soul." The doctrine of the pre-existence,—revealed so plainly, particularly in latter days, pours a wonderful flood of light upon the otherwise mysterious problem of man's origin. It shows that man, as a spirit, was begotten and born of heavenly parents, and reared to maturity in the eternal mansions of the Father, prior to coming upon the earth in a temporal body to undergo an experience in mortality. It teaches that all men existed in the spirit before any man existed in the flesh, and that all who have inhabited the earth since Adam have taken bodies and become souls in like manner. 

It is held by some that Adam was not the first man upon this earth, and that the original human being was a development from lower orders of the animal creation. These, however, are the theories of men. The word of the Lord declares that Adam was "the first man of all men" (Moses 1:34), and we are therefore in duty bound to regard him as the primal parent of our race. It was shown to the brother of Jared that all men were created in the beginning after the image of God; and whether we take this to mean the spirit or the body, or both, it commits us to the same conclusion: Man began life as a human being, in the likeness of our heavenly Father. 

True it is that the body of man enters upon its career as a tiny germ or embryo, which becomes an infant, quickened at a certain stage by the spirit whose tabernacle it is, and the child, after being born, develops into a man. There is nothing in this, however, to indicate that the original man, the first of our race, began life as anything less than a man, or less than the human germ or embryo that becomes a man.[72]

The anti-evolutionary sentiment is evident, though guarded. Did the article really constitute an authoritative pronouncement against evolution as a possibility for the origin of man's body? The likelihood that it did was strengthened by a statement in the 1910 manual for the Priests of the Aaronic Priesthood, which indicated that man's "descent has not been from a lower form of life, but from the Highest Form of Life; in other words, man is, in the most literal sense, a child of God. This is not only true of the spirit of man, but of his body also. There never was a time, probably, in all the eternities of the past, when there was not men or children of God. This world is only one of many worlds which have been created by the Father through His Only Begotten."[73]

But the statement continues, in a markedly less definitive vein: ". . . Adam, then, was probably not the first mortal man in the universe, but he was likely the first for this earth." And two pages later, the tone of indefiniteness is further continued as a matter of reasoning: 

One of the important points about this topic is to learn, if possible, how Adam obtained his body of flesh and bones. There would seem to be but one natural and reasonable explanation, and that is, that Adam obtained his body in the same way Christ obtained his—and just as all men obtain theirs—namely, by being born of woman. 

"The Father has a body of flesh and bones as tangible as man's; the Son also." (Doc. & Cov., 130:22). Then what is more natural than to conclude that the offspring of such Beings would have bodies of flesh and bones? Like begets like.[74]

Such sentiments were certain to evoke questions from Church members, and it was equally certain that they had to be handled at the highest level of the Church, the President's Office. Once again, the Improvement Era was the platform of response, in an editorial that has, so far as we can find, not been further commented on to this day.[75] Joseph F. Smith, as president of the Church, and Edward H. Anderson, were the editors. We quote it in toto, from the columns relegated to instructions to the priesthood: 

Origin of Man.—"In just what manner did the mortal bodies of Adam and Eve come into existence on this earth?" This question comes from several High Priests' quorums.

Of course, all are familiar with the statements in Genesis 1:26,27; 2:7; also in the Book of Moses, Pearl of Great Price, 2:27; and in the Book of Abraham 5–7. The latter statement reads: "And the Gods formed man from the dust of the ground, and took his spirit (that is, the man's spirit) and put it into him; and breathed into his nostrils the breath of life, and man became a living soul."

These are the authentic statements of the scriptures, ancient and modern, and it is best to rest with these, until the Lord shall see fit to give more light on the subject. Whether the mortal bodies of man evolved in natural processes to present perfection, through the direction and power of God; whether the first parents of our generations, Adam and Eve, were transplanted from another sphere, with immortal tabernacles, which became corrupted through sin and the partaking of natural foods, in the process of time; whether they were born here in mortality, as other mortals have been, are questions not fully answered in the revealed word of God. For helpful discussion of the subject, see Improvement Era, Vol. XI, August 1908, No. 10, page 778, article, "Creation and Growth of Adam"; also article by the First Presidency, "Origin of Man," Vol. XIII, No. 1, page 75,1909. 

For clarification, the August 1908 article referred to was a response to a question raised about an even earlier article; the author of the two pieces, William Halls, had contended that Adam could not have been created full-grown, but must have gone through a natural childhood and adolescence. When pushed for documentation by Era readers who felt that such a view was incompatible with scriptural literalism, he answered, in the article cited by the editorial, that he could not document it, but that "When a passage of scripture taken literally contradicts a fundamental, natural law, I take it as allegorical; and in the absence of divine authority, put a construction on it that seems to harmonize with my experience and reason." 

So ended the matter, apparently, so far as Joseph F. Smith was concerned: the editorial listed three options, and it is evident that not one of them agrees with a literal interpretation of Moses 3:7or other such creation passages. 

The Improvement Era continued to publish articles on science and the gospel (mostly articles by Frederick Pack, a University of Utah geology professor) until April, 1911. A few months before, the very touchy matter of academic freedom in the Church school system had reared its head, regarding the propriety of teaching ". . . the theories of evolution as at present set forth in the text books, and also theories relating to the Bible known as 'higher criticism'. . . ." President Smith, in a special editorial,[76] reported to the Church on the matter. He indicated that ". . . it is well known that evolution and the 'higher criticism'—though perhaps containing many truths—are in conflict on some matters with the scriptures, including some modern revelation . . . ," and finally concluded: 

. . . it appears a waste of time and means, and detrimental to faith and religion to enter too extensively into the undemonstrated theories of men on philosophies relating to the origin of life, or the methods adopted by an Alwise Creator in peopling the earth with the bodies of men, birds and beasts. Let us rather turn our abilities to the practical analysis of the soil, . . . 

A companion editorial from President Smith was aimed more directly at the youth of the Church, and appeared in The Juvenile Instructor.[77] Though more general in its approach, it makes a finer distinction between the President's personal feelings and the Church position. His private views seem to be embodied in the following passage: 

. . . They [students] are not old enough or learned enough to discriminate, or put proper limitations upon a theory which we believe is more or less a fallacy. In reaching the conclusion that evolution would be best left out of discussions in our Church schools we are deciding a question of propriety and are not undertaking to say how much of evolution is true, or how much is false. We think that while it is a hypothesis, on both sides of which the most eminent scientific men of the world are arrayed, that it is folly to take up its discussion in our institutions of learning; and we cannot see wherein such discussions are likely to promote the faith of our young people. . . . 

But he clearly spelled out the Church position on the matter: 

. . . The Church itself has no philosophy about the modus operandi employed by the Lord in His creation of the world, and much of the talk therefore about the philosophy of Mormonism is altogether misleading. . . . 

With these deliverances, President Smith let the matter rest. No further clarification of his sentiments regarding the mechanism of creation was given, though certainly this was a golden opportunity if ever one existed. 

Two years later, in a conference address in Arizona, President Smith delivered himself of one further comment: 

. . . Man was born of woman; Christ, the Savior, was born of woman and God, the Father, was born of woman. Adam, our earthly parent, was also born of woman into this world, the same as Jesus and you and I. . . .[78]

When? How? And of whom? The statement is consistent with all three of the 1910 options, and these and further questions about Joseph F. Smith's beliefs on the matter can be answered only by extensive and tenuous proof-texting, a well known and notoriously unreliable method. Certain it is that he, one of the most scripturally committed of all LDS presidents, remained consistent with his predecessors and officially left the matter open and unresolved. Articles in the Improvement Era ranged widely over the issue, from condemnations of the whole idea of evolution to accounts of dinosaur digging. But no further authoritative statements were made until 1925, during the administration of President Heber J. Grant. 

That was the year of the famous Scopes trial in Dayton, Tennessee. Young John Scopes, a high school science teacher, was charged with the teaching of evolution, forbidden by state law. At least Scopes was the formal defendant; the trial really developed into a classic confrontation between fundamentalist theology and contemporary science. The event was a news highlight of the year, with correspondents from around the world converging on the tiny town for the great showdown. Religious spokesmen of many persuasions felt disposed to deliver themselves of commentary on the matter.[79] During the post-trial period came the document: “'Mormon' View of Evolution,” published over the signatures of Heber J. Grant, Anthony W. Ivins, and Charles W. Nibley, the LDS First Presidency.[80] In essence, it consists of paragraphs 3, 6, 7, 12, 16, and 17 of the 1909 statement by Joseph F. Smith, et. ah, with only a very few changes in text: deletion of a word or two, addition of several words for clarification, etc. Paragraphs 13 and 14, the 'anti evolution' ones (quoted above), are conspicuously absent. The entire message of the statement is to affirm the spiritual pedigree of man and the common descent of all men from an ancestor named Adam, who had taken upon himself "an appropriate body." 

As in its 1909 predecessor, the word "evolution" or its derivatives occurs only once, to the effect that man, formed in the image of God, ". . . is capable, by experience through ages and aeons, of evolving into a God." Seen against the background of the theological ferment of the day, this is an amazingly temperate document; none of the sloganeering and overdrawn rhetoric characteristic of the day, just a calm focussing on the critical matter of man's spiritual affinity with God. The Church was concerned for the well-being of religion in general, and thus sympathized with the plight of the religionists, but it could ill afford any extreme statements in the matter. 

The subsequent years of calm were broken in 1930, though the resulting perturbation was kept quietly within the closed circle of the general authorities. The relatively young apostle, Joseph Fielding Smith, delivered a lecture to the Genealogical Conference on April 5. In his characteristic style, he enthusiastically delivered himself of his thoughts on the creation of man, acknowledging that "The Lord has not seen fit to tell us definitely just how Adam came for we are not ready to receive that truth." But he also spelled out very clearly a disbelief in "pre-Adamites," peoples of any sort upon the earth before Adam, declaring that ". . . the doctrine of 'pre-Adamites' is not a doctrine of the Church, and is not advocated nor countenanced in the Church." Furthermore,

. . . There was no death in the earth before the fall of Adam. . . . All life in the sea, the air, on the earth, was without death. Animals were not dying. Things were not changing as we find them changing in this mortal existence, for mortality had not come. . . .[81]

Shortly after the publication of the speech, these concepts became a bone of contention: Brigham H. Roberts, the long-standing apologist of the Church, directly challenged the legitimacy of the remarks, in a letter to the First Presidency. Both Roberts and Smith were given opportunity to present their positions, both orally and in writing, to the Twelve and the Presidency. Roberts developed his ideas primarily from scripture, from science, and from Apostle Orson Hyde and President Brigham Young. Smith also used scripture, but leaned heavily on the Adam teachings of Orson Pratt, and on paragraph 13 of the 1909 statement of the First Presidency. This last item comprised his major piece of evidence. At last, convinced that continuation of the discussion would be fruitless, the First Presidency issued a seven-page directive to the other general authorities, reviewing in detail the entire discussion as described and then stating: 

. . . The statement made by Elder Smith that the existence of pre-Adamites is not a doctrine of the Church is true. It is just as true that the statement: "There were not pre-Adamites upon the earth," is not a doctrine of the Church. Neither side of the controversy has been accepted as a doctrine at all. 

Both parties make the scripture and the statements of men who have been prominent in the affairs of the Church the basis of their contention; neither has produced definite proof in support of his views. 

. . . Upon the fundamental doctrines of the Church we are all agreed. Our mission is to bear the message of the restored gospel to the people of the world. Leave Geology, Biology, Archaeology and Anthropology, no one of which has to do with the salvation of the souls of mankind, to scientific research, while we magnify our calling in the realm of the Church. . . .[82]

In addition to this written directive, the First Presidency called a special meeting of all the general authorities, the day after General Conference closed, to discuss the matter and deliver oral counsel. Apostle James E. Talmage records the following account of the meeting: 

. . . Involved in this question [Roberts' original query] is that of the beginning of life upon the earth, and as to whether there was death either of animal or plant before the fall of Adam, on which proposition Elder Smith was very pronounced in denial and Elder Roberts equally forceful in the affirmative. As to whether Preadamite races existed upon the earth there has been much discussion among some of our people of late. The decision reached by the First Presidency, and announced to this morning's assembly, was in answer to a specific question that obviously the doctrine of the existence of races of human beings upon the earth prior to the fall of Adam was not a doctrine of the Church; and, further, that the conception embodied in the belief of many to the effect that there were no such Preadamite races, and that there was no death upon the earth prior to Adam's fall is likewise declared to be no doctrine of the Church. I think the decision of the First Presidency is a wise one in the premises. This is one of the many things upon which we cannot preach with assurance and dogmatic assertions on either side are likely to do harm rather than good.[83]

The two contestants, Roberts and Smith, were thus directed to drop the matter; publication of a major manuscript previously written by Elder Roberts dealing with the subject (among others) was proscribed. 

But this proscription left the public record with only one side of the story, the speech of Elder Smith, which in many ways is an avowal of the position of the nineteenth century theologians. Not everyone in the governing quorums of the Church was content with such a situation. Nor was the record long in being balanced. On Sunday, August 9, 1931, Apostle Talmage took the stand in the Salt Lake Tabernacle worship service, and there delivered an address: "The Earth and Man."[84] Talmage's position, in light of the above restriction from the First Presidency, was admittedly a bit presumptive, which likely accounts for some of the characteristics of the text. The speech as we now have it in printed form is a rather neat bit of nimble footwork, a careful avoidance of any explicit stance that would come into direct conflict with particular sensitivities on the issue. Affirming his deep belief in the ultimate synthesis of God's word in both the rocks and the scriptures, Talmage promulgated a clear message of sensitivity to, and reception of, science and the scientific method—a point that is amply recognized in the vigorous, even scathing, denunciations of his speech by certain later commentators. Careful though he was, at least the public record was now more balanced, and Talmage (as was customary) sent a copy of the manuscript to the printers for publication. 

From certain quarters within the Twelve, however, opposition developed to the speech's publication. The subject was a matter of consideration in at least four subsequent meetings of the Twelve and/or the First Presidency, but eventually the First Presidency, after going over the manuscript very carefully with Elder Talmage, directed him to send it back to the publisher for inclusion in the next Church News. Furthermore, they instructed him to have it published also as a separate pamphlet, to be available upon request from the Church Offices. Both publications were released to the public November 21, 1931, and the speech has since enjoyed a long and favorable treatment from the Mormon publishing fraternity.[85]

The resulting stalemate continued for over two decades. Cognizant of the fact that writings and expressions of general authorities, no matter how intended, tend to become canonized by various elements of the Church community, the First Presidency continued the proscription against publication of the Roberts manuscript. In 1933 both Roberts and Talmage died; the essence of their philosophical legacy was continued by Apostles Widtsoe and Merrill. Apostle Smith, in the immediately ensuing years, also completed a manuscript of book-length, which outlined his objections to evolutionary concepts, and once again drove home his commitment to many of the basic concepts of nineteenth-century theologians—not drawing such concepts from them, of course, but arriving at essentially the same position by a similar, strongly literalistic interpretation of the scriptures. The record indicates that his manuscript was subjected to the same publication injunction as that of Roberts.[86] Widtsoe and Merrill, not sharing the views of Elder Smith in these matters, also acted as damping forces on overly literalistic interpretation. Their deaths in 1952 marked the end of an era. 

Apostle Smith began an open exposition of his views on April 22, 1953, in a speech at Brigham Young University entitled "The Origin of Man."[87] His speech to the June 1953 MIA Conference[88] continued the same theme: scriptural literalism on scientific matters, coupled with a virtually complete disregard for scientific data. A rapid though minor updating of his book manuscript followed, and it was apparently again submitted for publication. Though it was not approved, he pushed ahead with its publication, and by mid-1954 it was made available to the public under the title: Man His Origin and Destiny.[89]

The work marks a milestone. For the first time in Mormon history, and capping a full half-century of publication of Mormon books on science and religion, Mormonism had a book that was openly antagonistic to much of science.[90] The long-standing concern of past Church presidents was quickly realized: the book was hailed by many as an authoritative Church statement that immediately locked Mormonism into direct confrontation with science, and sparked a wave of religious fundamentalism that shows little sign of abatement. Others, mindful of the embarrassment which other Christian churches had suffered on issues of science, and fearful of the consequences for their own Church if the new stance was widely adopted, openly expressed their consternation. The President of the Church, David O. McKay, was a giant of tolerance; the differences in philosophy (within the Church framework) between the book's author and himself could hardly have been more disparate. But a President's actions are essentially authoritative; one tends to act cautiously in such a position, and a public settling of issues was apparently not acceptable to him. Though there is no formal record available of the deliberations involved, the ensuing reactions indicate a low-key, indirect, and peace-making response, at least as far as public utterances are concerned. 

Apostle Smith vigorously presented his basic thesis to the Seminary and Institute teachers of the Church, assembled in their periodic summer training session at Brigham Young University, on June 28, 1954.[91] Exactly nine days later, President J. Reuben Clark, Jr., second counselor in the First Presidency and a veteran of over twenty years' service in the Presidency, delivered (by invitation) his speech "When are the Writings or Sermons of Church Leaders Entitled to the Claim of Scripture?" His message was clear and hard-hitting; it has no peer in Mormon literature. Emphasizing that only the President of the Church may declare doctrine, give interpretation of scripture, ". . . or change in any way the existing doctrines of the Church. . . ," he proceeded to an examination of the scriptural affirmation that whatever the holders of the priesthood speak "when moved upon by the Holy Ghost shall be scripture. . . ."[92] He readily acknowledged that the scripture applied with special force upon the general authorities, but that: 

. . . They must act and teach subject to the over-all power and authority of the President of the Church . . . Sometimes in the past they have spoken "out of turn," so to speak. . . .

There have been rare occasions when even the President of the Church in his preaching and teaching has not been "moved upon by the Holy Ghost." You will recall the Prophet Joseph declared that a prophet is not always a prophet. . . .

. . . even the President of the Church, himself, may not always be "moved upon by the Holy Ghost," when he addresses the people. This has happened about matters of doctrine (usually of a highly speculative character) where subsequent Presidents of the Church and the peoples themselves have felt that in declaring the doctrine, the announcer was not "moved upon by the Holy Ghost." 

How shall the Church know. . . ? The Church will know by the testimony of the Holy Ghost in the body of the members, . . . and in due time that knowledge will be made manifest. . . .[93]

President Clark continued to hammer this concept home, referring to accounts in the New Testament of doctrinal differences among the apostles, relating the concept to our own day, reiterating continually that 

. . . even the President of the Church has not always spoken under the direction of the Holy Ghost, for a prophet is not always a prophet . . . in our own Church, leaders have differed in view from the first. 

. . . not always may the words of a prophet be taken as a prophecy or revelation . . . .

In his final paragraphs, he moved from the position of trying to define what is scripture to identifying what is not scripture, emphasizing that when any one other than the President of the Church attempts to proclaim any new doctrine, etc., unless acting specifically under the President's direction, the Church may know that the utterances are not scripture. His final expository paragraph reads: 

. . . When any man, except the President of the Church, undertakes to proclaim one unsettled doctrine, as among two or more doctrines in dispute, as the settled doctrine of the Church, we may know that he is not "moved upon by the Holy Ghost," unless he is acting under the authority of the President. . . . 

Such teachings, to say the least, were not characteristic of what was usually taught over the pulpit. There was no mention in the sermon of any specific con temporary teachings to which these principles were to be applied, but there also was left no doubt that they were to be applied. 

President McKay himself avoided any direct public statement on the matter. His closest approach to public commentary came from his beginning-of-the school-year speech to the Brigham Young University faculty, September 17, 1954.[94] He handled therein various categories of knowledge, and touched briefly upon the matter of science and religion. He averred that it is a "stern fact of life" that all living things obey fixed laws of nature and divine commands. He referred to the creation of man thusly: "When the Creator breathed into his nostrils the breath of life’ (and never mind when it was), 'and man became a living soul' God gave him the power of choice." In his closing sentence, he moved to 

. . . bless you [the faculty] with wisdom to know the truth as it is given by revealed word in the authorized books of the Church, bless you with the power to discern between truth and error as given by individuals . . . 

But this public response by the First Presidency obviously would not satisfy the questions in the minds of many members. Over the years, there seems to have been an almost constant stream of inquiries, both written and oral, concerning the doctrinal soundness of Apostle Smith's book and similar teachings. The response from the First Presidency has been consistent: an avowal that the Church has taken no official position on the matter of evolution and related subjects, that it has made no official statement on the subject, that the book in question is neither "authorized" by the Church nor "published by" the Church, that it "is not approved by the Church," and that it contains only the author's personal views. On occasion the inquirer was sent two documents: the 1909 statement by the First Presidency, and the 1931 speech by Talmage, with the admonition that the entire matter should be dealt with by "suspending judgment as long as may be necessary" until the complete truth should be perceived.[95] Throughout all such communications ran the sentiment of tolerance, open-mindedness, and a dedication to final truth. Even those who sought the First Presidency's evaluation of materials to be used in their teachings got no further response. 

And here, it seems, the matter rests, as far as authoritative statements are concerned. There has been no further official response, and it would appear that none is forthcoming. Rather lengthy explanations by past First Presidencies (among the materials mentioned, ref. 95) indicate that since such authoritative statements must be applicable to future developments as well as to the current state of knowledge, it is deemed wisest to let the matter rest without further development. 

Authoritative statements concerning scientific matters seem neither necessary nor desirable, even if the knowledge to make them did exist—and it seems clear that it does not. Effective arguments can be marshalled to support the point that such pronouncements, necessarily restrictive in their nature, would stifle the very experience that life is supposed to provide; they would be inimical to the very roots of the process of "evolving into a God.” The 1931 First Presidency's observation that these matters do not directly relate to "salvation" is astute as well as practical. Those who argue against evolution, for instance, do so usually from the proclaimed motivation that the concept is inimical to religion, that it leads necessarily to atheism and associated evils. The position is tenuous at best. Cases where such a process is alleged to have occurred appear to be far more often the result of the intense conflict and polarization between popular expressions of theology and biology, rather than the result of the concept of evolution per se. Darwin perceived that his views bore no necessary antagonism to religion,[96] and a non-LDS commentator recognized that fact in the following expression: 

Evolution, if rightly understood, has no theological or antitheological influence whatever. What is evolution? It is not an entity. It is a mode of creation. It leaves the whole field of Christian faith where and as it found it. Its believers and advocates may be theists, pantheists, or atheists. The causes of these radically different religious views cannot be sought in the one theory. They are to be found elsewhere.[97]

There are too many devout religious evolutionists to argue defensibly that a belief in evolution per se, stripped of the "either God or evolution" polemics, leads to religious deterioration; indeed, there are many both within the Church and without who will argue from personal experience that the concept of evolution can have precisely the opposite effect: a deepening of religious sentiment and spirituality due to the recognition that God is a God of law, of order, of rational behavior, rather than a deity of mystery, of transcendent and capricious whims. At the same time, there can be no denying the fact that the intense polemics of the theology-biology debate has polarized people into opposite camps detrimental to the cause of both. In our day and time, we do not need further schism; what the world is crying for is synthesis. People have been driven to opposite extremes in this matter because of respective truths that they found in whatever position they finally choose. Is it not time to recognize that each camp has truth, and try to take the best from both? 

Mormonism is committed to the concept of a lawful, loving, orderly Deity to whom capriciousness and deceit are anathema. The concept that God works through universal law, that He is God because of His obedience to and operation within the framework of such law, is fundamental. This gives Mormonism a basis for synthesis that exists in few if any other Western religions; it cannot be ignored with impunity. Mormonism's view that truth can be obtained empirically or pragmatically,[98] must also be kept constantly in mind; God speaks in more ways than just scripture or open revelation. 

It would appear that teachers in the Church cannot be honest in their teachings if they present only one point of view as the position of the Church. Whoso among them picks just one position from among the many articulated on these matters by Church leaders becomes guilty of teaching a part-truth, and witnesses immediately that he "is not moved upon by the Holy Ghost." And will not students who permit such teaching without clarifying the matter be equally guilty of perpetuating part-truths? It would seem to be high time that we insist on a greater honesty and scholarship in our gospel discussions; we owe future generations far better teaching than the current ones have been getting. In these respects, it is encouraging to note that the current Gospel Doctrine manual,[99] which deals directly with the creation scriptures from both the Bible and modern scripture, steers deliberately clear of any interpretational hang-ups. It propounds with Brigham Young that the critical message is not what method was used in creation, but that God was responsible for creation. 

Above all, it would appear that teachers should grow beyond pushing their own views or those of their favorite general authority, to embark on a quest for truth rather than an indoctrination of one-sided dogma. Perhaps the sentiments of Apostle John Taylor are relevant: 

I do not want to be frightened about hell-fire, pitchforks, and serpents, nor to be scared to death with hobgoblins and ghosts, nor anything of the kind that is got up to scare the ignorant; but I want truth, intelligence, and something that will bear investigation. I want to probe things to the bottom and to find out the truth if there is any way to find it out.[100]

And further: 

. . . our religion . . . embraces every principle of truth and intelligence pertaining to us as moral, intellectual, mortal and immortal beings, pertaining to this world and the world that is to come. We are open to truth of every kind, no matter whence it comes, where it originates, or who believes in it. . . . 

A man in search of truth has no peculiar system to sustain, no peculiar dogma to defend or theory to uphold; he embraces all truth, and that truth, like the sun in the firmament, shines forth and spreads its effulgent rays over all creation, and if men will divest themselves of bias and prejudice, and prayerfully and conscientiously search after truth, they will find it wherever they turn their attention.[101]

---

[1] By "evolution" in this article we refer only to the general concept that living things as we know them today have over a long period of time been developed by differentiation from a single or several primordial entities; i.e., descent with modification. Other tighter or more specialized definitions do not generally apply here; we shall be content with just the very general concept portrayed by Darwin, in his closing sentence to The Origin of Species (26. and all subsequent editions): "There is grandeur in this view of life, with its several powers, having been originally breathed by the Creator into a few forms or into one; and that, . . . from so simple a beginning endless forms most beautiful and most wonderful have been, and are being evolved." 

[2] Cf. Lerner, I. M., "The Concept of Natural Selection: A Centennial View," Proc. Am. Philosophical Soc, 103(2) :i73-i82, 1959; reprinted in Laetsch, W. M. (ed), The Biological Perspective (Little, Brown & Co., 1969). An excellent statement of what natural selection is, and isn't, is Dobzhansky, Th., "Creative Evolution," Diogenes, 60 ."62-74,1967. Materials pertinent to the current level of acceptance of the main body of evolutionary concepts are: Muller, H. J., "Biologists' Statement on Teaching Evolution," Bull. Atom. Scientists, 23:39-40, 1967, and S. Tax (ed.), Evolution After Darwin (U. of Chicago Press, i960), which encompasses in three volumes the proceedings of the Darwin Centennial Celebration (symposium) at the U. of Chicago in 1959. A rather critical but factually reliable appraisal of the current status of evolutionary knowledge, particularly as it applies to invertebrate animals, is Kerkut, G. A., Implications of Evolution (Pergamon Press, New York, i960). Reviews of this work by Bonner, J. T., Am. Sci., 49:240-244, 1961, and Dobzhansky, Th., Science, 133:752, 1961, will also prove valuable. The review by Bullock, W., J. Am. Sci. Affil., 16(14): 125-6, 1964 will be of particular interest to those interested in religious correlations. 

[3] Improvement Era (hereafter Era), 6:233, 1903; H. B. Lee, Ensign, 2(12)12-3, 1972.

[4] First Presidency (Joseph F. Smith, et. ah) Deseret News, Aug. 2, 1913 (also in Clark, James R., Messages of the First Presidency, 4:284-286,1970); H. B. Lee, Era, 73(6) =63-65,1970; Ensign, 3(1)104-108, 1973. 

[5] The Doctrine and Covenants of the Church of Jesus Christ of Latter-day Saints, 68:2-4.

[6] Clark, J. Reuben, Jr., "When Are Church Leader's Words Entitled to Claim of Scripture?" Church News section of Deseret News, July 31, 1954, pp. 2f; (text of a speech to LDS Seminary and Institute Teachers, BYU, July 7, 1954) is by far the most candid and valuable analysis of this problem by a general authority. 

[7] The best statement known to me on the intimacies of this relationship is in Joseph F. Smith's pledge to the church upon assuming its Presidency, November 10, 1901, Conference Reports, p. 82; also in Clark, James R., op. cit., 4:4-6, 1970. 

[8] To be very precise, it appears that no statement or revelation even from a President of the Church is binding on the Church as a body unless accepted by them by vote in conference (Testimony of President Joseph F. Smith in Proc. before the Committee on Privileges and Elections of the U. S. Senate (the Reed Smoot Case); 1:95-97, 1904). This distinction seems quite unnecessary in the current discussion, however, since neither lay-members nor general authorities take cognizance of it in general practice. 

[9] Barbour, I. G., Issues in Science and Religion (London: SCM Press, Ltd., 1966), analyzes the "gaps" problem nicely. Cf. also Dobzhansky, Th., The Biology of Ultimate Concern (New York: World Publishing Co., 1967), pp. 12-34. 

[10] We make no attempt here to analyze the validity of the argument. As with all other points to be discussed, we are here interested only in presenting positions. Those who wish to pursue the subject would do well to begin with D. R. Burrill (ed.), The Cosmological Arguments, A Spectrum of Opinion (Garden City, New York: Anchor 1967). 

[11] Cf. deBeer, Sir Gavin, Charles Darwin, A Scientific Biography (Garden City, New York: Anchor, 1963), pp. 266-275; a ls o F- Darwin (ed.), The Life and Letters of Charles Darwin (New York: Appleton, 1887), 2:146, and More Letters of Charles Darwin (New York: Appleton, 1903), 1:395. 

[12] McKay, David O., "A Message for LDS College Youth," BYU Address, October 10, 1952, BYU Extension Publications, pp. 6-7. The published version is poorly edited and proofed. We have corrected here the spelling of Millikan's name and added for clarity the word "to" shown in brackets. The deleted material is all consistent with the sentiments of the quote as here rendered, but too garbled for precise reconstruction. 

[13] An introduction to the non-LDS literature can be gained from: White, A. D., A History of the Warfare of Science with Theology in Christendom (1896, reprinted by Dover Publications, Inc., New York, i960, 2 vols.), and Loewenberg, B. J., Darwinism Comes to America, 1859-1900 (Philadelphia: Fortress Press, 1969). There is as yet no satisfactory review and introduction to LDS materials on the subject. 

[14] Cf. White, O. K., Jr., "Mormonism—A Nineteenth Century Heresy," J. Religious Thought, 26:44-55, 1969. That Brigham Young perceived these deep distinctions is evident: ". . . we differ from the Christian world in our religious faith and belief; and so we do very materially. I am not astonished that infidelity prevails to a great extent among the inhabitants of the earth, for the religious teachers of the people advance many ideas and notions for truth which are in opposition to and contradict facts demonstrated by science, and which are generally understood," Journal of Discourses (hereafter JD), 14:115,1871. 

[15] Of the many books available, L. Eiseley's Darwin's Century (Garden City, New York: Doubleday, 1958) is probably the best single general work. Also recommended are W. Irvine's Apes, Angels, and Victorians (Cleveland: World Publishing Co., 1955), and Sir G. deBeer's Charles Darwin, A Scientific Biography (Garden City, New York: Anchor, 1963). 

[16] Mayr, E., "The Nature of the Darwinian Revolution," Science, 176:981-989, 1972.

[17] It is a distortion to characterize the dispute as one between science and religion. The dispute was with specific theologies, not religion per se. The distinction is critical but usually overlooked. 

[18] The dispute over some of these issues, particularly the fourth, cannot be directly attributed to Darwin. There can be no doubt that his proposals intensified the concern over them, however, and they eventually became all part of one intermeshed debate. The inclusion here is thus not unjustified. 

[19] The Catholic Encyclopedia (New York: Robert Appleton Co., 1908), 4:470.

[20] Morris, H. M., Biblical Cosmology and Modern Science (Grand Rapids, Mich.: Baker Book House, 1970), p. 68. Cf. White, A. D., op. cit., 1:2-7 for variations on the theme.

[21] Times and Seasons (hereafter T&S), 5:615, 1844. An expanded and variant version of this statement appears in History of the Church, 6:308-309, edited by B. H. Roberts (2nd ed., 1962). In Smith, Joseph Fielding, (compiler), Teachings of the Prophet Joseph Smith (Salt Lake City: Deseret Book Co., 1958 printing), the same quote is given, pp. 350-352. Though the latter com piler cites the Times and Seasons as his source, he actually gives the HC account.

[22] See, for example, Journal of Discourses, 11:120 (1865); 13:248 (1870); 14:116 (1871); 16:167 (1873), 18:231-232 (1876). 

[23] Agood discussion of creation ex nihilo as it applies to Mormon thought is found in O. K. White, "The Social-Psychological Basis of Mormon New-Orthodoxy," MS thesis, Univ. of Utah, 1967, 87ff; also: "The Transformation of Mormon Theology," Dialogue, 5(2): 9-24, 1970. White maintains, quite justifiably, that Mormon authors consistently miss the deeper or even essential meanings of the doctrine, that of necessary versus contingent being. We emphasize, however, that the pre-occupation on the simpler level, creation out of nothing, is not that of Mormon writers alone; it is so used and defended by non-Mormon Christian writers on a broad front. White correctly points out that either interpretation of the doctrine is contradicted by Mormon theology and pronouncements. Cf. also Madsen, Truman, Instructor, 99:96-99, 1964, and Instructor, 99:236, 1964, and, for the most detailed treatment available in Mormon literature on the subject, McMurrin, S. M., The Theological Foundations of the Mormon Religion (Salt Lake City: Univ. of Utah Press, 1965). 

[24] Cf. Roberts, B. H., Comprehensive History of the Church (Salt Lake City: Deseret News Press, 1930), 2:404-406. 

[25] Smith, Joseph, T&S, 5 =615, 1844. As with fn. 21, an expanded version is found in Roberts, B. H., History of the Church, 6:310-311. It is Roberts who equates the term "co-equal" with "co-eternal." Once again, Joseph Fielding Smith, op. cit., 352-354, follows the Roberts' version. Cf. also Joseph Smith, T&S, 3:745, 1842. The errors in grammar, spelling, etc. are in the original. 

[26] Cf. D&C, 93:21-23, 29, 33-35; Book of Abraham (in The Pearl of Great Price, Church of Jesus Christ of Latter-day Saints, Salt Lake City, 1968 printing), 3:18. 

[27] Cf. Brigham Young: ]D 1:116 (1853); 3:35^ (1856); 7:285 (1859); 8:27 (i860); and Rich, W. O., Distinctive Teachings of the Restoration (Salt Lake City: Deseret News Press, 1962), ch. 3. 

[28] Considering just this point alone, one is mystified as to how some well-meaning Mormons have been able to align themselves with such ardent modern exponents of creation ex nihilo as the Creation Research Society, which exacts as part of its membership requirement a subscription to the following statement of belief: "All basic types of living things, including man, were made by direct creative acts of God during the Creation Week described in Genesis." 

[29] White, A. D., op. cit., vol. 1: pp. 5-10 and later. Suggestions were also made occasionally, though not forcefully, that the "days" were periods of indefinite length; cf. Greene, J. C, Darwin and the Modern World View (Mentor Books, 1963), pp. 18-19. Such views were lost in the melee, however. 

[30] Eiseley, op. cit., 233f.

[31] Opponents of this view exist, of course, both within Mormonism and without. Indeed, such dissident literature has been quite popular in Mormonism in recent years. The arguments advanced, however, have not been convincing to those professionally engaged in the specific fields of dispute—and, despite certain contrary rumors, the arguments have been honestly considered.

[32] Latter Day Saints Messenger and Advocate, 1:78, Feb. 1835. 

[33] T&S, 5:758, published Jan. 1, 1845. Emphasis and parentheses are in the original. Certain passages from the D&C will be discussed hereafter. 

[34] Statement attributed to Joseph Smith; Richards, F. D., and J. A. Little, (compilers), A Compendium of the Doctrines of the Gospel (Salt Lake City: Deseret News Co., 1882), stereotype edition, p. 287. An examination of the prophet's speeches indicates that he usually followed this distinction. 

[35] JD, 18:231-232, 1876. 

[36] JD, 14:115-116, 1871. Lest LDS geologists become overly smug from these statements, however we point out that they too could share Brigham's disdain, cf. JD, 13:248-249,1870; Deseret News, June 18, 1873, p. 308. The statements are still consistent with the above, however. 

[37] There is no legitimate discussion of the word "kind" (Hebrew = min) in biological terms known to me in Mormon literature. For a beginning discussion, not LDS, see Jones, A. J., "A General Analysis of the Biblical 'Kind' (Min)," Creation Research Society Quarterly, 9(1) :53-57, 1972; and "Boundaries of the Min: An Analysis of the Mosaic Lists of Clean and Unclean Animals," Ibid., 9(2): 114-123, 1972; and references cited therein. Most current writers consider "kind" to represent a biological grouping at approximately the Family level in the taxonomic hierarchy; few indeed are those who still try to equate it with "species." 

[38] Cf. Eiseley, op. cit., or any good text of the history of biology. 

[39] Cf. Ruse, M., "Definitions of Species in Biology," British Journal for Philosophy of Science, 20:97-119, 1969, or any good text in systematics or evolution. Also of interest is C. Zirkle, "Species Before Darwin," Proc. Amer. Philosoph. Soc, 103:636-644,1959. 

[40] Smith, Joseph, as taken from Wilford Woodruff's notes, in B. H. Roberts (compiler), History of the Church, 4:554, from a speech delivered March 20,1842; cf. also Roberts' qualifying comments on the notes, ibid., 556n, which must be kept in mind regarding all such speech texts. We have not been able to locate any earlier published accounts. 

[41] JD, 8:29-30, 1860. 

[42] JD, 26:20, 1884. 

[43] Simpson, G. G., The Meaning of Evolution (New Haven: Yale Univ. Press, 1949), pp. 124- 129, 263-279. Simpson, usually pictured as quite insensitive to religious viewpoints, develops some concepts of the limitations and implications of materialism that have considerable interest to Mormons. 

[44] Schubert-Soldern, R., Mechanism and Vitalism, Philosophical Aspects of Biology, edited by P. G. Fothergill (South Bend, Indiana: University of Notre Dame Press, 1962), pp. 10-11.

[45] Hardin, G., Biology, Its Principles and Implications, 2nd ed. (San Francisco: W. H. Freeman and Co., 1966), p. 11. 

[46] Roberts, B. H., A Comprehensive History of the Church, 1930, 2:392. A close friend of Joseph Smith's, Benjamin F. Johnson, makes the "light-life-spirit" equation in his 1903 letter to Elder George F. Gibbs, p. 5, typescript copy; copy available in Brigham Young University library. 

[47] Andrus, H. L., Cod, Man and the Universe (Salt Lake City: Bookcraft, 1968), pp. 144-192.

[48] Roberts, op. cit., 2:381-412, especially 399-401. 

[49] D&C 131:7-8. 

[50] Deseret News, 10(21): 162-163, July 25, 1860, and 14(47) :372–373, August 23, 1865; also in Clark, J. R., Messages of the First Presidency 2:214-223, 229-240, 1965.

[51] Compare the first edition, 1855, Key to the Science of Theology, printed by J. Sadler, Liverpool, with later editions. 

[52] JD, 3:276-277, 1856. Benjamin F. Johnson, op. cit., pp. 5-6 indicates that essentially this same doctrine was taught by Joseph Smith. 

[53] eg., JD, 1:349 (1853); 3:354 (I856); 7:2-3, 285 (1859); 9:242 (1862). 

[54] In Lee, H. B., "Find the Answers in the Scriptures," Ensign, 2(12) :2–3, Dec. 1972, there does appear a passage which seems to imply an authoritative acceptance of the literal interpretation of Moses 3:7. Correspondence which we are not at liberty to release, however, indicates that this should not be construed as a pronouncement of any particular interpretation or doctrinal position. 

[55] e.g., from Brigham Young, JD, 3:319 (1856); 4:216-218 (1857); 7:285 (1859); 15:137 (1872).

[56] Roberts, B. H., History of the Church, 6:476, a speech by Joseph Smith dated June 16,1844, as taken from notes by Thomas Bullock. We have not been able to locate any earlier published sources. Cf. also fn. 40. 

[57] We are well aware of the intense arguments and deeply-held opinions revolving around this doctrine, and the current propensity to deny that it was ever taught. There can be no justification for denying its historical reality; it is too well documented, and was taught by Brigham Young from 1852 until his death in 1877. cf. R. Turner, "The Position of Adam in Latter-day Saint Scripture and Theology," MA thesis, Division of Religion, Brigham Young University, 1953. A more recent and thorough account is O. Kraut, Michael/Adam, n.d., n.p., but published in 1972. Both sources discuss reactions of church members to the doctrine, which include problems with scriptural reconciliation. Those who attempt to prove that Brigham Young taught only doctrine that is currently orthodox are driven to an inexcusable exercise of freedom in interpreting, and even a doctoring of, his critical sermons; e.g., Widtsoe, J. A. (comp.); Discourses of Brigham Young, p. 159, 1925 edition. These errors are resolutely compounded and further promulgated by Smith, Joseph Fielding, e.g., Answers to Gospel Questions (1966), 5:121-128, excerpted in the 1972-73 Melchizedek Priesthood manual, pp. 20-22. Compare, for example, the quote from JD, 9:148 in its original form and as printed by Widtsoe, loc. cit.; by Smith, p. 124, and in the priesthood manual, p. 22. 

We do not contend that President Young's concepts concerning Adam are an accurate representation of the concepts of other LDS presidents, or that they are to be accepted as basic Church doctrine. That to President Young Adam was a resurrected being is clear: 

The mystery is this, as with miracles, or anything else, is only to those who are ignorant. Father Adam came here, and then they brought his wife. "Well," says one, "Why was Adam called Adam"? He was the first man on the earth, and its framer and maker. He, with the help of his brethren, brought it into existence. Then he said, "I want my children who are in the spirit world to come and live here. I once dwelt upon an earth something like this, in a mortal state, I was faithful, I received my crown and exaltation. I have the privilege of extending my work, and to its increase there will be no end. I want my children that were born to me in the spirit world to come here and take tabernacles of flesh, that their spirits may have a house, a tabernacle or a dwelling place as mine has, and where is the mystery? (Deseret News, vol. 22:308, June 18, 1873, reporting a speech of June 8, 1873). 

But later presidents did not share this view. Nels Nelson, What Truth Is (Salt Lake City: Stevens and Wallis, Inc., 1947), pp. 60-61, reports that his request to President John Taylor for information on the subject elicited a reply which "told me without qualification that 'Adam and Eve while in the Garden of Eden were translated human beings.'" Further, a similar request from Bishop Joseph H. Eldredge of Myton, Utah, to President Heber J. Grant was answered, stating: "If what is meant is that Adam has passed on to celestial glory through a resurrection before he came here, and that afterwards he was appointed to this earth to die again, the second time becoming mortal, then it is not scriptural or according to the truth. . . . Adam had not passed through the resurrection " The letter, signed by President Grant and dated Feb. 26, 1931, is published in Clark, James R., Messages of the First Presidency, 5:289–290, 1971. Typescript copies, usually dated erroneously 1936, and carrying the signatures of both President Grant and David O. McKay (his counselor) have been widely circulated in Church circles for many years. Such differences in viewpoint should not be upsetting to those who have studied their Church history, but should serve as a caution to all who are tempted to teach any given doctrine about Adam as "the Church view." Consider also the message of J. Reuben Clark, Jr., fn. 6. 

[58] Cf. Turner and/or Kraut, fn. 57, for appropriate references. 

[59] Millenial Star, 17:297-298, 1855. 

[60] Deseret News, 10(21) :162-163, July 25, i860. The First Presidency's statement was reprinted as part of the 1865 refutation also, cf. fn. 50. The 'revised' version of Pratt's sermon may also be found in JD, 7:371-376. 

[61] Taylor, J., Mediation and Atonement (Salt Lake City: Deseret News Co., 1882), pp. 163-165; 1950 reprint, Stevens and Wallis, Inc., Salt Lake City, pp. 159-160. 

[62] JD, 24:61, cf. also 24:257, 1883. 

[63] Juvenile Instructor, 18:191, June 15, 1883. President Cannon appears to have addressed essentially the same theme in his Founder's Day speech at the Brigham Young Academy (University) in 1896. The best account I have been able to locate of this speech quotes Cannon only "in substance," however, so it is impossible to determine his exact statements. The basic stance, however, is anti-evolutionary, at least with respect to human origins; cf. Daily Enquirer (Provo, Utah), 14 (116): 1, October 16,1896. 

[64] See, for example, Millenial Star, 23(41): 651-654, October 12, 1861.

[65] Cf. Turner and/or Kraut, fn. 57, and "Journal of Abraham H. Cannon," entries of March 10, 1888, and June 23,1889; originals in Brigham Young University Library. 

[66] Bitton, D., "Anti-Intellectualism in Mormon History," Dialogue, 1(3) :111-134, 1966.

[67] Widtsoe, J. A., Joseph Smith As Scientist, A Contribution to Mormon Philosophy (Salt Lake City: The General Board (of the) Young Men's Mutual Improvement Associations, 1908)

[68] Editor's Table, Era, 12:489-494, April 1909. 

[69] Era, 12:505-509, May 1909, a reprint from the February 11, 1909, Millenial Star.

[70] Era, 13:75-81, November 1909; also in Clark, J. R., Messages of the First Presidency, 4:199- 206, 1970. Actually, this statement is the work of a special committee appointed for its production. James E. Talmage, not yet one of the general authorities, was a member, and records meeting with the committee on the dates of Sept. 27 and 30, 1909, to consider the document; cf. "Personal Journal of James Edward Talmage," 12:91-92, under the above dates, originals in Brigham Young University library. 

[71] This numbering counts only the paragraphs of the actual text; scriptural quotations are not counted. J. R. Clark, who does count them separately, would refer to these paragraphs as 30-32; cf. Messages of the First Presidency, 5:243,1971. 

[72] When this statement was reprinted in Smith, Joseph Fielding, Man His Origin and Destiny (Salt Lake City: Deseret Book Co., 1954), the phrase "primal parent of our race" was changed to read "primal parent of the race," cf. p. 354; and it continues to be quoted thus incorrectly in other Mormon works. To some students, this represents an alteration in meaning. Whether it would have been so interpreted by the 1909 First Presidency, however, is moot.

[73] Divine Mission of the Savior, Course of Study for the . . . Priests (2nd year), prepared and issued under the direction of the general authorities of the Church (1910), p. 35. The statement to this point was reprinted in the Church News section, Deseret News, September 19,1936, p. 8, and is often quoted as though complete in itself. 

[74] Ibid, p. 37. The manual at this point cites three statements, one each from Brigham Young (JD, 1:50); Parley P. Pratt (Key to Theology); and Orson Pratt (JD, 21:201). No attempt is made in the manual to capture the complete thought of these statements; particularly the ser mons of President Young and Orson Pratt reveal some fundamental differences in total content and concept. In fairness, it must also be admitted that major sentiments in both these sermons were severely compromised by statements of subsequent presidencies. 

[75] Era, 13:570, April 1910. 

[76] Era, 14:548-551, April 1911. Further details of the case are found in Chamberlin, R. V., Life and Philosophy of W. H. Chamberlin (Salt Lake City: Deseret News Press, 1925), pp. I4of. In this rather trying incident, three BYU faculty members, Henry Peterson, Joseph Peterson, and Ralph V. Chamberlin, resigned under pressure. 

[77] Juvenile Instructor, 46(4) 1208-209, April 1911. 

[78] Deseret News, December 27, 1913, Sec. Ill, p. 7; reprinted in the Church News section of Deseret News, September 19, 1936, pp. 2, 8. 

[79] The best single account is deCamp, L. S., The Great Monkey Trial (Garden City, N. Y.: Doubleday and Co. Inc., 1968). 

[80] Era, 28:1090-1091, September 1925. The understandable sympathy of the LDS people for the general religious position in the 1925 Scopes episode is reflected in the remarks of various speakers, both general authorities and otherwise, during the October General Conference (cf. LDS General Conference Reports, October, 1925). Of the First Presidency, however, counselor Charles W. Nibley made no reference to the matter; President Heber J. Grant went no further than to recall favorable impressions of William Jennings Bryan, the chief religious spokesman (and prosecutor) at the Scopes trial, who died shortly after the trial. Anthony W. Ivins, first counselor, addressed the topic of evolution directly and at some length, essentially articulating a middle-of-the-road position. The speech (ibid., pp. 19-28) is too loaded with hypothetical statements and qualifiers to be easily categorized. 

[81] Smith, Joseph Fielding, "Faith Leads to a Fulness of Truth and Righteousness," Utah Genealogical and Historical Magazine, 21:145-158, October 1930. 

[82] Typescript copy in author's possession, 7 pp. Cf. also fn. 54, which relates to a 1972 commentary on the question of pre-Adamites. 

[83] "Personal Journal of James Edward Talmage," 29:42, under date of April 7, 1930; cf. also relevant entries under dates of Jan. 2, Jan. 7, Jan. 14, and Jan. 21, 1931, all in volume 29.

[84] Talmage, J. E., "The Earth and Man," Church News section of the Deseret News, Nov. 21, 1931, pp. 7-8. In pamphlet form it was "Published by the Church of Jesus Christ of Latter-day Saints," 16 pp. The speech has been republished various times, including by Brigham Young University Extension Publications, and was most recently published in the Instructor, 100(12): 474-477, December 1965, and 101(1) :9-n, 15, January 1966. 

[85] Cf. fn. 84. Elder Talmage discusses the matter thusly in his journal, after reviewing the Roberts-Smith episode: 

Many of our students have inferred from Elder Smith's address that the Church refuses to recognize the findings of science if there be a word in scriptural record in our interpretation of which we find even a seeming conflict with scientific discoveries or deductions, and that therefore the "policy" of the Church is in effect opposed to scientific research. 

In speaking at the Tabernacle on August 9 last I had not forgotten that in the pronouncement of the First Presidency mentioned under date of April 7 last it was advised and really required that the General Authorities of the Church refrain from discussing in public, that is preaching, the debatable subject of the existence of human kind upon the earth prior to the beginning of Adamic history as recorded in scripture; but, I had been present at a consultation in the course of which the First Presidency had commented somewhat favorably upon the suggestion that sometime, somewhere, something should be said by one or more of us to make plain that the Church does not refuse to recognize the discoveries and demonstrations of science, especially in relation to the subject at issue. President Anthony W. Ivins, of the First Presidency, presided at the Tabernacle meeting, and three members of the Council of the Twelve were present—Elders George F. Richards, Joseph Fielding Smith and Richard R. Lyman. Of course, Elder Smith, and in fact all of us, recognize that my address was in some important respects opposed to his published remarks, but the other brethren named, including President Ivins, expressed their tentative approval of what I had said.

I am very grateful that my address has come under a very thorough consideration, and I may say investigation, by the First Presidency and the Council of the Twelve. The discussions throughout as relating to the matter have been forceful but in every respect friendly, and the majority of the Twelve have been in favor of the publication of the address from the time they first took it under consideration. I have hoped and fervently prayed that the brethren would be rightly guided in reaching a decision, and, as the Lord knows my heart, I have had no personal desire for triumph or victory in the matter, but have hoped that the address would be published or suppressed as would be for the best. The issue is now closed; the address is in print. ("Personal Journal of James Edward Talmage," 29:68-69, under date of November 21, 1931. Cf. also the comments under dates of August 9, November 5, November 16, and November 17, 1931, all in volume 29.) 

[86] Though considerable evidence verifying this account is already available in the public record, the primary documentation lies in confidential interviews conducted by the author with persons closely associated with this matter. 

The title of the Roberts manuscript, still unpublished, is "The Truth, The Way, The Life: An Elementary Treatise on Theology." Consisting of nearly 600 manuscript pages, it was considered by Roberts to be "the most important work that I have yet contributed to the Church, the six volumed Comprehensive History of the Church not omitted." (Letter of Feb. 9, 1931 to the First Presidency). Though it is in many critical ways contrapositive to the theology championed by Elder Smith, the reader should not infer that it is an acceptance or affirmation of evolution per se. 

[87] Smith, Joseph Fielding, "The Origin of Man," April 22, 1953, published by Brigham Young University Extension Division, 6 pp. 

[88] Smith, Joseph Fielding, "Entangle Not Yourselves in Sin," speech of June 12, 1953, Era, 56:646^ September 1953. 

[89] Smith, Joseph Fielding, Man, His Origin and Destiny (Salt Lake City, Utah: Deseret Book Co., 1954). 

[90] So far as I am aware, the first book in Mormonism that can really be said to be directed to a discussion of science and religion is Scientific Aspects of Mormonism, by Nels L. Nelson (New York: G. P. Putnam's Sons, 1904). Others followed sporadically over the years, by Widtsoe, Nel son, Pack, and Merrill. All of these, while not preaching a scientific humanism or anything of the sort, exhibit a deep recognition of the validity of scientific knowledge. Man His Origin and Destiny is a clean break with that long tradition, opting as it does for schism rather than synthesis. 

[91] Smith, Joseph Fielding, speech of June 28, 1954, published in the Church News section, Deseret News, July 24,1954, under the caption "Discusses Organic Evolution Opposed to Divine Revelation." 

[92] Cf. ref. 5. 

[93] Cf. ref. 6. Words in parentheses, grammatical errors, etc. are in the original.

[94] McKay, David O., "Some Fundamental Objectives of a Church University," Church News Section, Deseret News, Sept. 25,1954, p. 2f. 

[95] I have photostatic copies in my files of several of these inquiries and responses, and know of additional oral discussions of the matter. Before his death, Pres. McKay gave formal permission for the publication of at least one of the written responses. It is not deemed appropriate here to anticipate that publication in excessive detail. 

[96] As it is expressed in the Conclusion to The Origin, "1 see no good reason why the views given in this volume should shock the religious feelings of anyone." Though Darwin, once a candidate for the ministry, came to feel that the entire question of rational evidence for design and/or the existence of God was "insoluble," he was clear that religious commitment was a matter separate and distinct from belief or disbelief in either evolution or natural selection. 

[97] Thompson, W. R., Catholic World, 34:692,1882. 

[98] Cf. Rich, Wendell O., Distinctive Teachings of the Restoration, Ch. 7, "The Nature of Truth" (Salt Lake City: Deseret News Press, 1962). The First Presidency's straightforward statement: "That which is demonstrated, we accept with joy . . ." (Deseret News, December 17, 191.0, part i, p. 3) can be coupled with dozens of further references. 

[99] In the Beginning, Gospel Doctrine Course Teacher's Supplement, 1972, Corporation of the President of the Church of Jesus Christ of Latter-day Saints, Deseret News Press.

[100] JD, 11:317, 1867. 

[101] JD, 16:369-370,1874.

[post_title] => Seers, Savants and Evolution: The Uncomfortable Interface [post_excerpt] => Dialogue 8.3/4 (1973): 43–73
Ever since his great synthesis, Darwin's name has been a source of discomfort to the religious world. Too sweeping to be fully fathomed, too revolutionary to be easily accepted, but too well documented to be ignored, his concepts of evolu￾tion1 by natural selection have been hotly debated now for well over a century. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => seers-savants-and-evolution-the-uncomfortable-interface-2 [to_ping] => [pinged] => [post_modified] => 2024-01-10 22:15:03 [post_modified_gmt] => 2024-01-10 22:15:03 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=17143 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1

WP_Post Object ( [ID] => 17159 [post_author] => 2887 [post_date] => 2018-04-27 14:36:12 [post_date_gmt] => 2018-04-27 14:36:12 [post_content] =>

Henry Eyring, Distinguished Professor of Chemistry and Metallurgy at the University of Utah, is probably the most widely known scientist in the Church. He was born in 1901 in the Mormon community, Colonia Juarez, Chihuahua, Mexico. As a boy he helped his father wrangle cattle on their ranch. In 1912, the family fled as refugees from the Mexican Revolution and settled in Pima, Arizona. 

Over the years Henry Eyring's status in the first rank of scientists has become secure. He has produced a staggering volume of research publications in the fields of his interests: application of quantum mechanics and statistical mechanics, radio activity, theory of reaction rates, theory of liquids, rheology, molecular biology, optical rotation, and theory of flames. He is a longstanding member of the National Academy of Science. His work has led to seventeen major awards, thirteen honorary degrees, and leadership in numerous professional organizations, including terms as president of the American Association for the Advancement of Science and the American Chemical Society. 

Henry Eyring is a man of warmth and wit. Tor the past sixteen years, he has put up prize money for the first four places in a fifty-yard dash run by his ten to twenty graduate students. He is a regular competitor, though the students seem to run faster than they once did. 

He has served faithfully in various Church positions. He was district president in New Jersey while teaching at Princeton, presiding, as he says, over 3,000,000 persons, "though most of them were blissfully unaware of the fact." He served on the General Board of the Sunday School for twenty-five years and presently serves as a stake high councilman. 

Edward L. Kimball, Professor of Law at Brigham Young University, conducted the interview for Dialogue. His mother is Henry Eyring's eldest sister. 

Kimball: To what do you trace your strong commitment to education? 

Eyring: My grandfather Eyring spoke seven languages and had a good education and was very much in favor of education. My father went to Brigham Young Academy when it was still a high school. Although my mother only went through fifth grade, she was well-educated and later taught school. She was a quick person who read a great deal and learned readily. I grew up in a family that spoke good English. I think I had all the advantages I would have had if my parents had had college degrees. My uncle, Carl Eyring, went to BYU and started his Ph.D. with Milliken at Chicago and finished at CalTech. My oldest sister motivated me very much. She came back from school in Utah and told me I ought to get a Ph.D. 

I never had any other idea but that I would go to college. My parents were poor, but not so poor that they could not let me go, providing I could work my way through school. I was quite able to do that. As a matter of fact, the first year I had a $500 scholarship and that meant I had money to send home. 

Kimball: How did your career in science begin? 

Eyring: I took my bachelor's degree in mining at the University of Arizona and then was an engineer in the Inspiration Copper Company in Miami, Arizona, and in Sacramento Hill in Bisbee, Arizona. Rather early in my mining career I was working as a timberman repairing a squareset when a rock about as big as my head came down and hit my foot so that my boot filled with blood. I was glad to get out of that place. It was a death trap. I left, not so much because I was frightened as because it seemed stupid to stay where one was gambling without enough to win to justify it. I neither wanted to work in the mine myself nor to send other men into it.

I went back to get my master's degree in metallurgy and then worked at the United Verde Smelter in Clarkdale, Arizona. I remember very well the day when I was in the blast furnace aisle where there were about twenty blast furnaces belching out sulphur dioxide. I had my handkerchief dipped in bicarbonate and was putting it over my face. The superintendent of the smelter came up behind me and said, "Eyring, I like the way you are working out here at the smelter. If you stay here another three weeks, I am going to put you in charge of these blast furnaces." That is when he lost a metallurgist. I took up chemistry. I got a Ph.D. from Berkeley, taught briefly at the University of Wisconsin, spent time as a National Research Fellow in Berlin, and taught for fifteen years at Princeton before coming to the University of Utah in 1946 as dean of the Graduate School. 

Kimball: You were on the General Board of the Sunday School for many years, weren't you? 

Eyring: Yes, in fact, they asked me before I came. Milton Bennion, my wife's uncle, had inside information that I was coming to the University of Utah. He was dean of the School of Education and wrote me a letter before I even left Princeton, and I accepted. I was on the Board for twenty-five years. 

Kimball: Were there assignments you particularly enjoyed as a member of the Board? 

Eyring: I particularly enjoyed my assignment as chairman for the Gospel Doctrine committee. We had to prepare a new set of lessons every year, though of course we had help. Associating with faithful Sunday School workers throughout the Church was tremendously rewarding. 

Kimball: I understand you were part of a high-level meeting to plan the new Church magazines. 

Eyring: That is an amusing story. I got a letter from Richard L. Evans to come down to a two o'clock meeting for the new magazines, along with a great many other people. I was visiting your parents and I said, "I am going to a meeting for the magazines." Your father said, "I am going, too, at nine o'clock." I had forgotten in the meantime that mine was for two o'clock and assumed it was the same meeting. My secretary was not there that morning and I was a little bit late, so I hurried down to the Church Office Building. When I got there, I went in and said to the receptionist that I was supposed to go to a meeting. He said, "Well, isn't it this afternoon?" I said, "No, it is this morning." And so he took me in and there were four apostles—your father, Marion Romney, Brother Evans and Brother Hunter—and the magazine editors. I was quite surprised that there was no one else from the Sunday School but I thought, well, they must regard me very highly, and so I just sat down. Your father shook my hand, so did Marion, and everyone—I knew them, you know—so I sat down. The discussion went around and I was willing to offer my views quite freely. However, Brother Evans said, "Your turn will come in a few minutes." 

When they got around to me, I told them that the Church magazines never would amount to a damn if they did not get some people with independence in there who had real ideas and would come out and express themselves. If they were going to rehash old stuff, they would not hold the young people. I told them I thought that Dialogue had caught the attention of more people and had more influence than our own Church magazines did. It has some of the kind of independence that I think is a good thing. I think it is walking a very dangerous road and could easily go sour, but so far it has been good. And I told them that if they left out people like Brother Wheelwright, who had been working with the Instructor, they would be making a big mistake, and so on. I gave them quite a bit of very fine advice and I damned a little Avhen I wanted to and when I got through, Brother Evans said, "I do not know anyone who characterizes the idea of independence any more than you do; are you applying for the job?" I said, "No, I am not applying for the job, but I think I have given good advice/' Everyone was very nice to me. 

I did not have any feeling, even after I had been there, that there was anything wrong, and thought that they must have a high opinion of my wisdom. When I got back to my office, my secretary asked, "Where have you been?" I said I had been down to that Church magazine meeting. She said, "That is this afternoon at two o'clock." 

What is so funny is not that I made a mistake, but that I was so insensitive as to not realize it. I did not go to the two o'clock meeting. I felt I had done my work. Brother Evans got up in that meeting and, I am told, said that they had had a meeting in the morning and that very useful advice had been supplied by Brother Eyring. He did not say I had not been invited. 

I am amazed at the graciousness of the brethren in making me feel I belonged, when any one of them might well have been annoyed. They are a most urbane group. On my part, there was no holding back; I just tried to help them all I could. 

Kimball: The scientist sometimes finds himself in the middle on things like the age of the earth controversy. What has been your experience? 

Eyring: When President Joseph Fielding Smith's book, Man, His Origin and Destiny, was published, someone urged it as an Institute course. One of the Institute teachers came to me and said, "If we have to follow it exactly, we will lose some of the young people." I said, "I don't think you need to worry." I thought it was a good idea to get the thing out in public, so the next time I went to Sunday School General Board meeting, I got up and bore my testimony that the world was four or five billion years old, that the evidence was strongly in that direction. That week, Brother Joseph Fielding called and asked me to come in and see him. We talked for about an hour. He explained his views to me. I said, "Brother Smith, I have read your books and know your point of view, and I understand that is how it looks to you. It just looks a little different to me." He said as we ended, "Well, Brother Eyring, I would like to have you come in and let me talk with you some time when you are not quite so excited." As far as I could see, we parted on the best of terms. 

I would say that I sustained Brother Smith as my Church leader one hundred percent. I think he was a great man. He had a different background and training on this issue. Maybe he was right. I think he was right on most things and if you followed him, he would get you into the Celestial Kingdom—maybe the hard way, but he would get you there. 

The Church, according to a letter from President McKay, has no position on organic evolution. Whatever the answer is to the question, the Lord has already finished that part of His work. The whole matter poses no problem to me. The Lord organized the world and I am sure He did it in the best way. 

Kimball: Members of the Church often express pride that an eminent scientist is a faithful Latter-Day Saint. 

Eyring: I think that is the wrong point of view. I have told this story often: I serve on the Board of the Welch foundation. A man named Robert A. Welch struck oil and left what is now an endowment of about 120 million dollars dedicated to the development of chemistry in Texas. Each year we have had the ablest people in the world come to discuss some subject. At the first discussion, which was on the nucleus of the atom, there were about a dozen of us sitting around the lunch table. One of them turned to me and asked, "How many of these people believe in a Supreme Being?" I said, "I don't know; let's ask them." There was no objection. I said, "Now, let's put the question as clearly as we can. How many of you think that 'There is a Supreme Being' best represents your point of view, and how many think that 'There is no Supreme Being' best represents your point of view? Let's not have a long discussion about what we mean, but just choose between these two propositions." All twelve said they believed. 

I do not think there is anything unusual in physical scientists believing in a guiding, all-wise Being who runs the universe. They might differ in their kinds of theology, in men's interpretation of this big idea, but the best exact scientists in my experience are overwhelmingly believers. 

Kimball: Does it have anything to do with their being scientists? 

Eyring: I think they do not see how there could be all of the order in the universe unless there was something back of it. It is hard to believe that we just happened. It is not, of course, a matter of proof. Actually you do not ever prove anything that makes any difference in science or religion. You set up some postulates from your experience or your experiments and then from that you start making deductions, but everything that matters is based upon things you accept as true. 

When a man says he will believe religion if you can prove it, it is like asking you to prove there are electrons. Proof depends upon your premises. In Euclidian geometry, you learn that three angles of a triangle total 180 degrees and that two parallel lines never meet; the whole argument proceeds very logically. But there are other kinds of geometry. In elliptical geometry, parallel lines do meet and in hyperbolic geometry, they diverge. If you go up to the north pole and draw two parallels of longitude, they will hit the equatorial plane at right angles. That makes 180 degrees, plus the angle at the pole. And the lines are perfectly parallel at the equator, and the fellow that does not know they are curving will find that two parallel lines meet. It is a perfectly good geometry. It is two dimensional on the surface but it is curving in a third dimension. Analogously we do not know whether or not this three dimensional space we live in is curving in a fourth dimension. You can build your logic perfectly, but whether your postulates apply to the world you live in is something you have to get out of either experiment or experience. 

Every proof in science depends on the postulates one accepts. The same is true of religion. The certitude one has about the existence of God ultimately comes from personal experience, the experience of others or logical deductions from the postulates one accepts. People sometimes get the idea that religion and science are different, but they are not different at all. There is nothing in science that does not hinge on some primitive constructs you take for granted. What is an electron? I can tell you some things about the electron we have learned from experiment, and if you accept these things, you will be able to make predictions. But ultimately you always get back to postulates. 

I am certain in my own mind of the truthfulness of the gospel, but I can only communicate that assurance to you if you accept my postulates. 

Kimball: May I ask you some questions about your professional life? What would you consider your most important scientific contribution? 

Eyring: In 1935 I wrote a paper called "The Activated Complex" and practically everybody in the world who treats rates of chemical reactions uses it. It has stood now since 1935. It is a very simple equation. It says that how fast two molecules change partners depends on how hard they bump into each other. If they hit hard enough, the electrons that are holding the two pairs together reorganize and allow a change of partners. The rate of a reaction depends on how hard you have to push to come to the point of no return. It is the same equation that has to do with the fact that there are not many molecules of gas on top of high mountains because it takes work against gravity to get up there. There won't be many molecules that have energy enough to go over the gravity barrier. In fact you use exactly the same equation to calculate the barometric pressure as you do to calculate the rate of chemical reaction. 

Kimball: You don't mind if I do not understand that, do you? 

Eyring: But you do understand it. Let me tell you a typical chemical reaction. If you could look at a molecule closely, you would see that gravity acts like a spring that pulls it to the center of the earth. The chemical bond is not unlike the force of gravity. If in India you have a molecule and you want to have it go over a pass in the Himalayas into China, you have to stretch that spring. Since not many molecules stretch the bond that much, only a few drift over the pass into China. If you go high enough you won't find any molecules. That is analogous to a chemical reaction. You can write that as an equation: the rate of reaction is the chance of being at the top of the energy barrier times the rate of crossing it multiplied by the chance of not coming back across the barrier. 

Kimball: Would you mind telling about some of the projects you have worked on recently?

Eyring: One relates to cancer. What we have found out is a theory of mutation that explains the way chromosomes are changed inside the cell. There are forty-six chromosomes inside the human cell, twenty-three from each parent. Inside these chromosomes are genes. A gene is simply a pattern for making particular molecules. Some of these molecules promote bodily reactions. If you have those reactions going fast enough, the tissue grows. There are other molecules which inhibit growth. If you lose the ability to make these inhibitors because a certain part of the gene is damaged, you may have cancer. The forty-six chromosomes have about a million genes and a small number of them have to do with the crucial function of controlling rate of growth. They can be damaged by radiation or chemicals so that the genes are not coded to make the right molecules. The wrong molecules often are lethal, but the body's defense mechanism, the immune reaction, acts to destroy them. However, some of them leave the cell enough like it was that the body does not recognize it as an intruder. It is a Greek bearing gifts. This cell without the inhibitors grows out of control. That is what cancer is. The cells are much like they were before, but out of control. 

I have collaborated with Miss Betsy Stover who has been working the last twenty years on cancer mechanisms by injecting dogs with radioactive materials. Together we have written a number of papers interpreting the results of her experimentation. I have read these papers at about twenty universities. The theory that I write down is an equation which fits the data and gives insights into possible causes of cancer that one did not have before. I did not participate in the laboratory research, but I have a facility for seeing how one can explain the experimental results in terms of mechanisms and write equations for them. 

Eyring: Yes, because you can make deductions from it. You can start systematizing and interpreting experimental facts. Some facts are very simple. We are over engineered against damaging mutations. Chromosomes are getting damaged all the time, but they are also being repaired. While we are young, the repair process goes so fast that cell divisions which result in a seriously modified cell only rarely take place. In their youth, maybe five people per hundred thousand per year will get cancer. But by the time they get up to seventy, it will be 18,000 per hundred thousand because their reserves are used up. If you think of scissors cutting things and needles repairing them, they are running out of needles and thread, so they stay damaged and you get uninhibited growth. What is it that uses up the needles and thread? Bad living. Anything that makes you grow old will increase the likelihood of cancer. 

Kimball: I remember some research you did in wool fibers and in luciferase. 

Eyring: Yes, that is related to rates of chemical reactions. And we are still working on these questions. Rates of cooking, or growth of muscles, or tightening of muscles, or using the brain—everything involves the speed of some reactions. It really means getting acquainted with the molecules as if they were your friends and knowing what their nature is and what they will do, how hard you have to throw them at one another so they will change partners. It is like a detective story; it is the same kind of systematizing. Every time you get a nice new tool there are some puzzles you can solve. 

Kimball: Is there any way of identifying the quality in yourself that makes you so successful in this kind of enterprise? 

Eyring: I would think that I have a facility for seeing analogies. And I am not easily deterred by criticism. I do chemistry to suit myself. I am glad if other people like what I do, but fundamentally I do it for my own understanding. 

I think I get along well with people so others like to work with me. I have had the privilege of training and directing no Ph.D's. By and large, I think of chemical research as my collaborators and I pitted against the complexities of nature. I never make my students do something alone if I know how to help them do it more easily. I do not put them on little jobs to find out how smart they are. I think they sense this attitude and give maximum cooperation. 

Kimball: Can you tell whether someone is going to be a good chemist when you meet him? 

Eyring: There are some factors I look for. One is whether he reacts quickly. You can talk with him and tell whether he sees things and grasps ideas. But he has to be more than bright if he is going to be a good scientist. He also has to be interested. That takes longer to discover, but you can work with him for a little while and find out. Unless he just gets lost in his work and feels that knowing molecules is like knowing people, he probably won't get far. If he is a time server, if he just likes to work eight hours and then go do something else, he won't change the world. 

There are unsuccessful bright people who are so overcritical that they cannot even stand their own creativeness. Being critical slows down creativity because when you first get an idea, it generally does not come full-blown like Athena from the mind of Jove. If you are horrified because it is not perfect to begin with, you may abandon it. To be a successful scientist, it is often useful to be a happy muddler. 

Kimball: Do you ever publish papers that you are later embarrassed about? 

Eyring: Not that I am embarrassed about, but that perhaps I should be embarrassed about. 

I have published over five hundred scientific papers, frequently with collaborators. I have written nine books, also with collaborators. And I have been editor of about twenty annual reviews of physical chemistry, and co-editor of eleven volumes of physical chemistry. No, there is no paper I am ashamed of, because at the time it was written, it was the best we knew. I have no apologies. Each paper was the best I could do at the time. That I was not born smarter is really not my fault. Maybe as important as anything in whatever success I have had is the ability to go ahead continually without worrying whether other people like what I do. If an idea is wrong, it will fail; if it is right, nothing can stop it. 

I would say the same thing about the Church. The gospel, I am convinced, is true and I do not care about little things. I do not think anybody understands everything completely about the gospel. I think the best man in the world is human. The Lord does not just open and shut his mouth. I follow the Prophet Joseph for his moments of insight when the Lord showed him things. I have no objection to his making any number of mistakes. Of course he did, and I like it. I like to see some of the brethren make mistakes because then I think that the Lord can use me, too. I mean, it gives me comfort; it does not worry me. I know they are mortal, so I never worry about small things in the gospel. The brethren are wonderful, but they make mistakes. Of course, there are things they do not understand, just as there are many things I do not understand. 

Kimball: In your opinion, who is the greatest scientist in history? 

Eyring: Some professional mathematicians would pick Archimedes, Newton and Gauss as the three greatest. I would think that as a mathematician, Gauss was the greatest of them all. He started so many things! And he made almost no mistakes. He was a phenomenon, a tremendous person. He was also quite religious. 

Kimball: What about chemists? 

Eyring: I would say one of the greatest physical chemists was Peter Debye. He died recently. I knew him well; he was about fifteen years older than I. He was a very great man. Emil Fischer, a German, in organic chemistry was tremendous. Again, to pick out any one can give the wrong impression. There are many others of comparable attainments. 

Kimball: Einstein was at the Institute for Advanced Study at Princeton when you were there. He is the scientist laymen know best. What is your view of him? 

Eyring: He was first rate, there is no question about it. It was no accident that he was good in many fields, but the picture some people have of him as a lone intellectual giant is a wrong one. I prefer to think of him as a man with few peers. There are other people who are comparable. Neils Bohr was another physicist of comparable scientific influence. 

Kimball: The only thing most people know about Einstein is his theory of relativity. 

Eyring: Yet he did not get the Nobel prize for that, but for the photoelectric effect. The photoelectric effect has to do with the emission of electrons when a ray of light strikes certain chemicals. And the color of the light determines the speed at which the electron will come out. As he explained it, light is made of particles. Just as the electron is a particle, so light is a particle. The light particle has energy in it which is transferred to the electron. The more violet the light, the more energy it has. 

Kimball: Does the fact that he received the Nobel prize for this discovery mean that it was a more valuable contribution than the theory of relativity?

Eyring: No, it means that the discovery of photoelectric effect was clean cut. It was true; it was a discovery you could write something simple about, and it was his. All of those things go into a Nobel prize. They tend to give the prize to people who have done other important things, but they ordinarily identify it with some specific contribution. 

Kimball: The head of one of the departments at the University of Wisconsin mentioned that he thought you ought to have had the Nobel prize long ago. 

Eyring: I am available. 

Kimball: Have you made some kind of specific contribution that might attract their attention? 

Eyring: Possibly the reaction rate theory. Although I made it almost forty years ago, it might fall in that category. 

Kimball: Wouldn't it be embarrassing for them to go back that far? It would be something of an admission that they waited a generation too long. 

Eyring: They sometimes make the award for overall contributions. A case could be made for the idea that reaction rate theory has been the most influential concept in chemistry since its formulation. And my work on theories of liquids might also be considered. 

Kimball: Is there anyone, outside science, you particularly admire? 

Eyring: I admire your father. He is a remarkable man. He seems to me a selfless person who has found something to serve that is bigger than himself. I think that is always a great thing. 

Kimball: He works at the Church much as you work at chemistry. 

Eyring: The same way. He forgets himself in it. He is a great man. I know others. I know many people in the Church for whom I have that kind of feeling, but none that I know who are more devoted than your father and my mother. My mother had that same quality of selflessness. 

Kimball: What is most important to you? 

Eyring: I think the gospel and my family and friends. And I enjoy science. I am interested in it like some people get interested in a game, or in making money. It is fun to try and understand how things fit together. Life is to me an exciting game, and the concept of eternal progression which the gospel teaches gives meaning to it all.

[post_title] => A Dialogue with Henry Eyring [post_excerpt] => Dialogue 8.3/4 (1973): 99–108
Over the years Henry Eyring's status in the first rank of scientists has become secure. He has produced a staggering volume of research publications in the fields of his interests: application of quantum mechanics and statistical mechanics, radio￾activity, theory of reaction rates, theory of liquids, rheology, molecular biology, optical rotation, and theory of flame. [post_status] => publish [comment_status] => closed [ping_status] => closed [post_password] => [post_name] => a-dialogue-with-henry-eyring [to_ping] => [pinged] => [post_modified] => 2024-01-29 21:59:11 [post_modified_gmt] => 2024-01-29 21:59:11 [post_content_filtered] => [post_parent] => 0 [guid] => https://www.dialoguejournal.com/?post_type=dj_articles&p=17159 [menu_order] => 0 [post_type] => dj_articles [post_mime_type] => [comment_count] => 0 [filter] => raw ) 1